콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU131771

Sigma-Aldrich

MISSION® esiRNA

targeting human HAS2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TTTGGGTGTGTTCAGTGCATTAGTGGACCTCTGGGAATGTACAGAAACTCCTTGTTGCATGAGTTTGTGGAAGATTGGTACAATCAAGAATTTATGGGCAACCAATGTAGCTTTGGTGATGACAGGCATCTCACGAACCGGGTGCTGAGCCTGGGCTATGCAACAAAATACACAGCTCGATCTAAGTGCCTTACTGAAACACCTATAGAATATCTCAGATGGCTAAACCAGCAGACCCGTTGGAGCAAGTCCTACTTCCGAGAATGGCTGTACAATGCAATGTGGTTTCACAAACATCACTTGTGGATGACCTACGAAGCGATTATCACTGGATTCTTTCCTTTCTTTCTCATTGCCACAGTAATCCAGCTCTTCTACCGGGGTAAAATTTGGAACATTCTCCTCTTCTTGTTAACTGTCCAGCTAGTAGGTCTCATAAAATCATCTTTTGCCAGCTGCCTTA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hong Zhan et al.
Fertility and sterility, 114(4), 888-898 (2020-08-09)
To investigate the role(s) of hyaluronan synthase 2 (HAS2) and hyaluronan in disease progression of endometriosis and epidermal growth factor (EGF)-induced motility changes of endometriotic cells. A case-control experimental study and in vitro primary cell culture study. University hospital-affiliated research centers.
Xiaoyan Chen et al.
Cell communication and signaling : CCS, 18(1), 89-89 (2020-06-11)
Hyaluronan (HA) is an abundant component of the bone marrow (BM) extracellular matrix. Here, we investigated the abnormal deposition of HA in the BM microenvironment and its remodelling in mediating the malignancy of breast cancer cells (BCCs). BCCs were transplanted
Douglas Hanniford et al.
Cancer cell, 37(1), 55-70 (2020-01-15)
Metastasis is the primary cause of death of cancer patients. Dissecting mechanisms governing metastatic spread may uncover important tumor biology and/or yield promising therapeutic insights. Here, we investigated the role of circular RNAs (circRNA) in metastasis, using melanoma as a
Priscilla Soulié et al.
American journal of physiology. Cell physiology, 307(8), C745-C759 (2014-08-29)
Generation of branched tubes from an epithelial bud is a fundamental process in development. We hypothesized that induction of hyaluronan synthase (Has) and production of hyaluronan (HA) drives tubulogenesis in response to morphogenetic cytokines. Treatment of J3B1A mammary cells with

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.