콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU130251

Sigma-Aldrich

MISSION® esiRNA

targeting human NR2E1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGAATGGGACCCCAATGTATCTCTATGAAGTGGCCACGGAGTCGGTGTGTGAATCAGCTGCCAGACTTCTCTTCATGAGCATCAAGTGGGCTAAGAGTGTGCCAGCCTTCTCCACGCTGTCTTTGCAAGACCAGCTGATGCTTTTGGAAGATGCTTGGAGAGAACTGTTTGTTCTAGGAATAGCACAATGGGCCATTCCGGTTGATGCTAACACTCTACTGGCTGTATCTGGCATGAACGGTGACAACACAGATTCCCAGAAGCTGAACAAGATCATATCTGAAATACAGGCTTTACAAGAGGTGGTGGCTCGATTTAGACAACTCCGGTTAGATGCTACTGAATTTGCCTGTCTAAAATGCATCGTCACTTTCAAAGCCGTTCCTACACATAGTGGTTCTGAACTGAGAAGTTTCCGGAATGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Meng-Lay Lin et al.
Oncotarget, 6(25), 21685-21703 (2015-08-19)
The Nuclear Receptor (NR) superfamily of transcription factors comprises 48 members, several of which have been implicated in breast cancer. Most important is estrogen receptor-α (ERα), which is a key therapeutic target. ERα action is facilitated by co-operativity with other
Kristine Griffett et al.
Cell chemical biology, 27(10), 1272-1284 (2020-08-09)
TLX is an orphan nuclear receptor that plays a critical role in both embryonic and adult neurogenesis, as well in the pathogenesis of glioblastomas. TLX functions predominately as a transcriptional repressor, but no natural ligands or high-affinity synthetic ligands have
J Song et al.
Cell death & disease, 6, e1844-e1844 (2015-08-08)
In the central nervous system (CNS), hyperglycemia leads to neuronal damage and cognitive decline. Recent research has focused on revealing alterations in the brain in hyperglycemia and finding therapeutic solutions for alleviating the hyperglycemia-induced cognitive dysfunction. Adiponectin is a protein

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.