설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
TGTTGTTAGAGGGCCCAGAGTTCCTTCTCCACCCCCGCTCTCTCTCTCTTGGCCTGAGATCTCTGTGCAGGAACCAAGATGGGGCTGAAGCCTCTGGAGGCAGTTGGTTGGGGGCGGGCAGGCAGGAGGCCCTCCCTCCACCCCCCCACCCTCAGCCCGGCAACTTCTGGGTTCCATGGGTTTTAGTTCCGTTCTCGTTTTCTTCCTCCGTTATTGATTTCTCCTTTCTCCCTAAGCCCCCTTCTGCTTCCACGCCCTTTTCCTCTTTGAAGAGTCAAGTACAATTCAGACAAACTGCTTTCTCCTGTCCAAAAGCAAAAAGGCAAAGGAAAGAAAGAAAGCTTCAGACCGCTAGTAAGGCTCAAAGAAGAAGAAAAACACCAAAACCACAAGGGAAAAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... UNC5B(219699) , UNC5B(219699)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Zongyi Xie et al.
Brain, behavior, and immunity, 69, 190-202 (2017-11-23)
Neuroinflammation is an essential mechanism involved in the pathogenesis of subarachnoid hemorrhage (SAH)-induced brain injury. Recently, Netrin-1 (NTN-1) is well established to exert anti-inflammatory property in non-nervous system diseases through inhibiting infiltration of neutrophil. The present study was designed to
Junhui Chen et al.
Journal of cellular and molecular medicine, 23(3), 2256-2262 (2019-01-08)
Netrin-1 (NTN-1) is a novel drug to alleviate early brain injury following subarachnoid haemorrhage (SAH). However the molecular mechanism of NTN-1-mediated protection against early brain injury following SAH remains largely elusive. This study aims to evaluate the effects and mechanisms
Bo Wang et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 34(5), 939-954 (2019-01-16)
Normal bone mass is maintained by balanced bone formation and resorption. Myosin X (Myo10), an unconventional "myosin tail homology 4-band 4.1, ezrin, radixin, moesin" (MyTH4-FERM) domain containing myosin, is implicated in regulating osteoclast (OC) adhesion, podosome positioning, and differentiation in
Feng Zhang et al.
Nature communications, 7, 13517-13517 (2016-11-25)
Vascular permeability and neovascularization are implicated in many diseases including retinopathies and diabetic wound healing. Robo4 is an endothelial-specific transmembrane receptor that stabilizes the vasculature, as shown in Robo4
Dan Liu et al.
BMC ophthalmology, 14, 102-102 (2014-08-26)
Netrin-1 has been reported to promote retinal neovascularization in oxygen-induced retinopathy (OIR). However, netrin-1 receptors, which may mediate netrin-1 action during retinal neovascularization, have not been characterized. In this study, we investigated netrin-1 receptor subtype expression and associated changes in
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.