설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ATGTGGAGGCAAAGGTTGTCTGTCTTTTCCGGCGCAGGGACATTTCTAGTAGCCTCAACAGCCTGGCTGATAGTAATGCCAGGGAGTTTGAAGAGGAATCAAAGCAGCCAGGGGTGTCTGAGCAGCAGCGCCATCAACTGAAGCACCGGGAACTTTTTCTTTCTCGGCAATTTGAATCATTACCAGCCACCCACATACGGGGGAAATGCAGTGTGACCCTCTTGAATGAGACAGATATCTTGAGCCAGTACCTGGAAAAGGAGGACTGCTTTTTTTACTCACTGGTGTTTGACCCCGTGCAGAAGACACTTCTCGCTGATCAGGGCGAGATTAGAGTTGGTTGCAAATACCAAGCTGAGATCCCAGATCGCCTAGTAGAGGGAGAATCTGATAATCGGAACCAGCAGAAGATGGAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MTA2(9219) , MTA2(9219)
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Bin Zhang et al.
Japanese journal of clinical oncology, 45(8), 755-766 (2015-05-15)
Metastasis-associated protein 2 is considered as an intrinsic subunit of the nucleosome remodelling and histone deacetylase complex, which contributes to the epigenetic silencing genes. More and more evidence suggests that metastasis-associated protein 2 is required to maintain the malignant phenotype
Ioannis Sanidas et al.
Molecular cell, 73(5), 985-1000 (2019-02-04)
Hyper-phosphorylation of RB controls its interaction with E2F and inhibits its tumor suppressor properties. However, during G1 active RB can be mono-phosphorylated on any one of 14 CDK phosphorylation sites. Here, we used quantitative proteomics to profile protein complexes formed
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.