콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU106621

Sigma-Aldrich

MISSION® esiRNA

targeting human SUMO1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TCAAAGACAGGGTGTTCCAATGAATTCACTCAGGTTTCTCTTTGAGGGTCAGAGAATTGCTGATAATCATACTCCAAAAGAACTGGGAATGGAGGAAGAAGATGTGATTGAAGTTTATCAGGAACAAACGGGGGGTCATTCAACAGTTTAGATATTCTTTTTATTTTTTTTCTTTTCCCTCAATCCTTTTTTATTTTTAAAAATAGTTCTTTTGTAATGTGGTGTTCAAAACGGAATTGAAAACTGGCACCCCATCTCTTTGAAACATCTGGTAATTTGAATTCTAGTGCTCATTATTCATTATTGTTTGTTTTCATTGTGCTGATTTTTGGTGATCAAGCCTCAGTCCCCTTCATATTACCCTCTCCTTTTTAAAAATTACGTGTGCACAGAGAGGTCACCTTTTTCAGGACATTGCATTTTCAGGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Sabine Hergovits et al.
Journal of cellular and molecular medicine, 21(11), 3087-3099 (2017-06-01)
Interleukin (IL)-6-type cytokines have no direct antiviral activity; nevertheless, they display immune-modulatory functions. Oncostatin M (OSM), a member of the IL-6 family, has recently been shown to induce a distinct number of classical interferon stimulated genes (ISG). Most of them
Yufeng Yao et al.
Pulmonary pharmacology & therapeutics, 55, 38-49 (2019-02-01)
Pulmonary arterial hypertension (PAH) is a life-threatening disease without effective therapies. PAH is associated with a progressive increase in pulmonary vascular resistance and irreversible pulmonary vascular remodeling. SUMO1 (small ubiquitin-related modifier 1) can bind to target proteins and lead to
Lin-Nan Zhu et al.
Frontiers in cellular neuroscience, 12, 262-262 (2018-09-11)
Methamphetamine (METH) is an illegal and widely abused psychoactive stimulant. METH abusers are at high risk of neurodegenerative disorders, including Parkinson's disease (PD). Previous studies have demonstrated that METH causes alpha-synuclein (α-syn) aggregation in the both laboratory animal and human.
Dao-Ying Yuan et al.
Oncology reports, 38(4), 2360-2368 (2017-08-10)
Radiotherapy is one of the most effective non-surgical treatments for oral squamous cell carcinoma. However, radioresistance remains a major impediment to radiotherapy. Although BetA (Betulinic acid) can induce radiosensitization, the underlying mechanism and whether it could induce radiosensitization in oral

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.