설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AAGTTCCAAGACACCGATGGCAAACACCTGCTGCCAAAGATCAGGGACAGCGCGGGGCAGAAGGGCACAGGGAAGTGGACCGCCATCTCCGCCCTGGAATACGGCGTACCCGTCACCCTCATTGGAGAAGCTGTCTTTGCTCGGTGCTTATCATCTCTGAAGGATGAGAGAATTCAAGCTAGCAAAAAGCTGAAGGGTCCCCAGAAGTTCCAGTTTGATGGTGATAAGAAATCATTCCTGGAGGACATTCGGAAGGCACTCTACGCTTCCAAGATCATCTCTTACGCTCAAGGCTTTATGCTGCTAAGGCAGGCAGCCACCGAGTTTGGCTGGACTCTCAATTATGGTGGCATCGCCCTGATGTGGAGAGGGGGCTGCATCATTAGAAGTGTATTCCTAGGAAAGATAAAGGATGCATTTGATCGAAACC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Xiaoyu Yang et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 20(9), 1145-1152 (2018-01-18)
6-phosphogluconate dehydrogenase (6PGD), a key enzyme of the oxidative pentose phosphate pathway, is involved in tumor growth and metabolism. Although high 6PGD activity has been shown to be associated with poor prognosis, its role and therapeutic value in breast cancer
Jun Cao et al.
The American journal of the medical sciences, 360(3), 279-286 (2020-08-25)
The essential role of 6-phosphogluconate dehydrogenase (6PGD), the enzyme catalyzing the oxidative pentose phosphate pathway, in tumor growth and metabolism has garnered attention in recent years. In this work, we are the first to demonstrate that aberrant activation of 6PGD
Wujian Zheng et al.
Frontiers in pharmacology, 8, 421-421 (2017-07-18)
Cisplatin (DDP) is currently one of the most commonly used chemotherapeutic drugs for treating ovarian and lung cancer. However, resistance to cisplatin is common and it often leads to therapy failure. In addition, the precise mechanism of cisplatin resistance is
활성 필터
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.
