콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU106111

Sigma-Aldrich

MISSION® esiRNA

targeting human KRT17

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CGCACCAAGTTTGAGACAGAGCAGGCCCTGCGCCTGAGTGTGGAGGCCGACATCAATGGCCTGCGCAGGGTGCTGGATGAGCTGACCCTGGCCAGAGCCGACCTGGAGATGCAGATTGAGAACCTCAAGGAGGAGCTGGCCTACCTGAAGAAGAACCACGAGGAGGAGATGAACGCCCTGCGAGGCCAGGTGGGTGGTGAGATCAATGTGGAGATGGACGCTGCCCCAGGCGTGGACCTGAGCCGCATCCTCAACGAGATGCGTGACCAGTATGAGAAGATGGCAGAGAAGAACCGCAAGGATGCCGAGGATTGGTTCTTCAGCAAGACAGAGGAACTGAACCGCGAGGTGGCCACCAACAGTGAGCTGGTGCAGAGTGGCAAGAGTGAGATCTCGGAGCTCCGGCGCACCATGCAGGCCTTGGAGATAGA

Ensembl | 인체 수납 번호

ENSG00000186831

NCBI 수납 번호

NM_000422

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... KRT17(3872) , KRT17(3872)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
QCS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Chun-Ying Xiao et al.
Chinese medical journal, 133(24), 2910-2918 (2020-11-26)
Psoriasis is a common chronic inflammatory skin disease with 2% to 3% prevalence worldwide and a heavy social-psychological burden for patients and their families. As the exact pathogenesis of psoriasis is still unknown, the current treatment is far from satisfactory.
Daisuke Ujiie et al.
Carcinogenesis, 41(5), 591-599 (2019-11-23)
Adjuvant chemotherapy is considered for patients with stage II colorectal cancer (CRC) characterized by poor prognostic clinicopathological features; however, current stratification algorithms remain inadequate for identifying high-risk patients. To develop prognostic assays, we conducted a step-wise screening and validation strategy
Mihaela Chivu-Economescu et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 20(6), 948-959 (2017-03-17)
Keratin 17 (KRT17) was shown to be an important molecular marker for predicting the carcinogenesis, progression, and prognosis of various cancer types. Our previous studies identified KRT17 as a possible biomarker for gastric cancer by gene microarray, with an elevated
Hui Liu et al.
Gene, 563(1), 35-40 (2015-03-10)
Hereditary protein C deficiency (PCD) is an autosomal inherited disorder associated with high risk for venous thromboembolism (VTE). This study aimed to explore the functional consequences of two missense mutations, p.Asp297His and p.Val420Ile, responsible for type I/II PCD and recurrent
Jason D Arroyo et al.
Nucleic acids research, 42(9), 6064-6077 (2014-03-07)
Unlike short interfering RNAs (siRNAs), which are commonly designed to repress a single messenger RNA (mRNA) target through perfect base pairing, microRNAs (miRNAs) are endogenous small RNAs that have evolved to concurrently repress multiple mRNA targets through imperfect complementarity. MicroRNA

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.