콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU090991

Sigma-Aldrich

MISSION® esiRNA

targeting human PAX6

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

ATGAGGCTCAAATGCGACTTCAGCTGAAGCGGAAGCTGCAAAGAAATAGAACATCCTTTACCCAAGAGCAAATTGAGGCCCTGGAGAAAGAGTTTGAGAGAACCCATTATCCAGATGTGTTTGCCCGAGAAAGACTAGCAGCCAAAATAGATCTACCTGAAGCAAGAATACAGGTATGGTTTTCTAATCGAAGGGCCAAATGGAGAAGAGAAGAAAAACTGAGGAATCAGAGAAGACAGGCCAGCAACACACCTAGTCATATTCCTATCAGCAGTAGTTTCAGCACCAGTGTCTACCAACCAATTCCACAACCCACCACACCGGTTTCCTCCTTCACATCTGGCTCCATGTTGGGCCGAACAGACACAGCCCTCACAAACACCTACAGCGCTCTGCCGCCTATGCCCAGCTTCACCATGGCAAATA

Ensembl | 인체 수납 번호

ENSG00000007372

NCBI 수납 번호

NM_001604

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... PAX6(5080) , PAX6(5080)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Zhe Qian et al.
Respiratory research, 19(1), 262-262 (2018-12-31)
This study investigated the function of SMAD3 (SMAD family member 3) in regulating PAX6 (paired box 6) in non-small cell lung cancer. First, qRT-PCR was employed to detect SMAD3 expression in cancer tissues along with normal tissues and four cell lines
Hassan Akrami et al.
Journal of ophthalmic & vision research, 4(3), 134-141 (2009-07-01)
To establish human retinal pigment epithelial (RPE) cell culture as a source for cell replacement therapy in ocular diseases. Human cadaver globes were used to isolate RPE cells. Each globe was cut into several pieces of a few millimeters in
Akira Ooki et al.
Oncogene, 37(45), 5967-5981 (2018-07-08)
It remains unclear whether PAX6 acts as a crucial transcription factor for lung cancer stem cell (CSC) traits. We demonstrate that PAX6 acts as an oncogene responsible for induction of cancer stemness properties in lung adenocarcinoma (LUAD). Mechanistically, PAX6 promotes
Yi Lu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 129, 110381-110381 (2020-09-06)
Colorectal cancer is a kind of gastrointestinal tumor with rising morbidity and mortality. 5-fluorouracil is one of the most effective chemotherapy drugs for the treatment of CRC. However, clinical data reported dramatic resistance on the treatment for CRC with 5-fluorouracil.
Zhengjia Liu et al.
American journal of translational research, 12(6), 2538-2553 (2020-07-14)
This article explored LINC01619 impact on non-small cell lung cancer (NSCLS) development. LINC01619 expression in tumor tissues/normal tissues of NSCLS patients was detected by qRT-PCR and in situ hybridization. PAX6 expression in clinical tissues was researched by immunohistochemistry. After transfection
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.