추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
GAGAGAGAACAGAATGTCAAGAATCAGGACTTGTTGCAGCAGGAAATCGAAGACTGGAGTAAATTACATGCTGAGCTCAGTGAGCAAATCAAATCATTTGAGAAGTCTCAGAAAGATTTGGAAGTAGCTCTTACTCACAAGGATGATAATATTAATGCTTTGACTAACTGCATTACACAGTTGAATCTGTTAGAGTGTGAATCTGAATCTGAGGGTCAAAATAAAGGTGGAAATGATTCAGATGAATTAGCAAATGGAGAAGTGGGAGGTGACCGGAATGAGAAGATGAAAAATCAAATTAAGCAGATGATGGATGTCTCTCGGACACAGACTGCAATATCGGTAGTTGAAGAGGATCTAAAGCTTTTACAGCTTAAGCTAAGAGCCTCCGTGTCCACTA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MIA3(375056) , MIA3(375056)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Journal of the American Heart Association, 9(7), e014146-e014146 (2020-04-03)
Background Epistasis describes how gene-gene interactions affect phenotypes, and could have a profound impact on human diseases such as coronary artery disease (CAD). The goal of this study was to identify gene-gene interactions in CAD using an easily generalizable multi-stage
Hepatology (Baltimore, Md.), 65(3), 983-998 (2017-01-01)
Fibrogenesis encompasses the deposition of matrix proteins, such as collagen I, by hepatic stellate cells (HSCs) that culminates in cirrhosis. Fibrogenic signals drive transcription of procollagen I, which enters the endoplasmic reticulum (ER), is trafficked through the secretory pathway, and
Nature cell biology, 22(1), 74-86 (2020-01-08)
Collagen is the most abundant secreted protein in vertebrates and persists throughout life without renewal. The permanency of collagen networks contrasts with both the continued synthesis of collagen throughout adulthood and the conventional transcriptional/translational homeostatic mechanisms that replace damaged proteins
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.