콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU081661

Sigma-Aldrich

MISSION® esiRNA

targeting human NTRK1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGCCTGCCTCTTCCTTTCTACGCTGCTCCTTGTGCTCAACAAATGTGGACGGAGAAACAAGTTTGGGATCAACCGCCCGGCTGTGCTGGCTCCAGAGGATGGGCTGGCCATGTCCCTGCATTTCATGACATTGGGTGGCAGCTCCCTGTCCCCCACCGAGGGCAAAGGCTCTGGGCTCCAAGGCCACATCATCGAGAACCCACAATACTTCAGTGATGCCTGTGTTCACCACATCAAGCGCCGGGACATCGTGCTCAAGTGGGAGCTGGGGGAGGGCGCCTTTGGGAAGGTCTTCCTTGCTGAGTGCCACAACCTCCTGCCTGAGCAGGACAAGATGCTGGTGGCTGTCAAGGCACTGAAGGAGGCGTCCGAGAGTGCTCGGCAGGACTTCCAGCGTGAGGCTG

Ensembl | 인체 수납 번호

ENSG00000198400

NCBI 수납 번호

NM_001012331

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NTRK1(4914) , NTRK1(4914)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Marzia Di Donato et al.
Cancers, 11(6) (2019-06-09)
Resistance to hormone therapy and disease progression is the major challenge in clinical management of prostate cancer (PC). Drugs currently used in PC therapy initially show a potent antitumor effects, but PC gradually develops resistance, relapses and spreads. Most patients
Wenyu Shi et al.
Molecular oncology, 11(9), 1189-1207 (2017-05-31)
Nucleophosmin-anaplastic lymphoma kinase-expressing (NPM-ALK+ ) T-cell lymphoma is an aggressive neoplasm that is more commonly seen in children and young adults. The pathogenesis of NPM-ALK+ T-cell lymphoma is not completely understood. Wild-type ALK is a receptor tyrosine kinase that is
Sam Faulkner et al.
The American journal of pathology, 188(1), 229-241 (2017-10-19)
Neurotrophin receptors are emerging targets in oncology, but their clinicopathologic significance in thyroid cancer is unclear. In this study, the neurotrophin tyrosine receptor kinase TrkA (also called NTRK1), the common neurotrophin receptor p75NTR, and the proneurotrophin receptor sortilin were analyzed
Xinyuan Yang et al.
Oncogene, 38(15), 2778-2787 (2018-12-14)
Multiple cancer signalling networks take part in regulatory crosstalks with the Hippo tumour suppressor pathway through the transcriptional cofactor Yes-associated protein (YAP). Nevertheless, how YAP is controlled by pathway crosstalks in tumourigenesis remains poorly understood. Here, we performed a targeted
M Rochman et al.
Mucosal immunology, 8(4), 785-798 (2014-11-13)
Although interleukin (IL)-13 and neurotrophins are functionally important for the pathogenesis of immune responses, the interaction of these pathways has not been explored. Herein, by interrogating IL-13-induced responses in human epithelial cells we show that neurotrophic tyrosine kinase receptor, type

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.