설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
CTGCAAGGTGGACAAACAGAACCGTGCTGGCTACAGCCCTATTATGCTCACCGCCCTGGCCACCCTGAAGACCCAGGACGACATCGAGACTGTCCTTCAGCTCTTCCGGCTTGGCAACATCAATGCCAAAGCCAGCCAGGCAGGACAGACGGCCCTGATGCTGGCCGTCAGCCACGGGCGGGTGGACGTTGTCAAAGCCCTGCTGGCCTGTGAGGCAGATGTCAACGTGCAAGATGATGACGGCTCCACGGCCCTCATGTGCGCCTGTGAGCACGGCCACAAGGAGATCGCGGGGCTGCTGCTGGCCGTGCCCAGCTGTGACATCTCACTCACAGATCGCGATGGGAGCACAGCTCTGATGGTGGCCTTGGACGCAGGGCAGAGTGAGATTGCGTCCATGCTGTA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... KANK2(25959) , KANK2(25959)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Frontiers in cell and developmental biology, 8, 125-125 (2020-03-21)
Integrins are heterodimeric glycoproteins that bind cells to extracellular matrix. Upon integrin clustering, multimolecular integrin adhesion complexes (IACs) are formed, creating links to the cell cytoskeleton. We have previously observed decreased cell migration and increased sensitivity to microtubule (MT) poisons
Nature materials, 18(6), 638-649 (2019-05-23)
The interrelationship between microtubules and the actin cytoskeleton in mechanoregulation of integrin-mediated adhesions is poorly understood. Here, we show that the effects of microtubules on two major types of cell-matrix adhesion, focal adhesions and podosomes, are mediated by KANK family
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.