콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU073541

Sigma-Aldrich

MISSION® esiRNA

targeting human MGEA5

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AACTGCACCTTGTGAATGGTAGTTGAGGTCTTCATACAGTTCAGCCTCTAGAATGGTAACAAATCAGCCAATTGGATTCGAAACAAAGAAGACTATGTAAAACTCACCCATCACACTTTGAGACTACTCACTGGTTGGAAGAATATAGTATTGCAGCAAATCCTGTATGAAAGAGAGATGTGGGCTTCCTTTTTGAGTCTTGTGTTAGGTGCTGAGACCTTTTACATGGGCTTATACAGGGAGAGAGTCTTCAATAAATGTAGTCAGCACTATTTTCTGCATCCAGTGTGGTTGCGTTTCTCACCTGAGAGTAATCAAGATAACATCTGTCATCTTCCTTGGTTTATTGAGTGAAATGCCTCTCAGTCTTAGGGGACATGGCAGAGATGAAAGAAAGAAAGAGTGGGTTTCAGAAGTGTCAGGGTGGAGTGATTCCAAGTGGGATGGTT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Miguel C Lucena et al.
The Journal of biological chemistry, 291(25), 12917-12929 (2016-04-30)
Deregulated cellular metabolism is a hallmark of tumors. Cancer cells increase glucose and glutamine flux to provide energy needs and macromolecular synthesis demands. Several studies have been focused on the importance of glycolysis and pentose phosphate pathway. However, a neglected
Md Ataur Rahman et al.
Oxidative medicine and cellular longevity, 2019, 6279313-6279313 (2019-12-13)
The addition of O-linked β-N-acetylglucosamine (O-GlcNAcylation) to serine and threonine residues is a common posttranslational modification of intracellular proteins which modulates protein functions and neurodegenerative diseases, controlled by a single pair of enzymes, O-GlcNAcase (OGA), and O-GlcNAcylation transferase (OGT). Autophagy
Anupriya Chatterjee et al.
Cells, 9(10) (2020-10-23)
Our previous studies identified that retinal endothelial damage caused by hyperglycemia or nucleoside diphosphate kinase-B (NDPK-B) deficiency is linked to elevation of angiopoietin-2 (Ang-2) and the activation of the hexosamine biosynthesis pathway (HBP). Herein, we investigated how NDPK-B is involved
Maïté Leturcq et al.
Cellular and molecular life sciences : CMLS, 75(23), 4321-4339 (2018-08-03)
O-GlcNAcylation of proteins is governed by O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA). The homeostasis of O-GlcNAc cycling is regulated during cell cycle progression and is essential for proper cellular division. We previously reported the O-GlcNAcylation of the minichromosome maintenance proteins

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.