콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU054291

Sigma-Aldrich

MISSION® esiRNA

targeting human NNMT

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGACAAGAAGGGCTGAACTGATGGAAGGAATGCTGTTAGCCTGAGACTCAGGAAGACAACTTCTGCAGGGTCACTCCCTGGCTTCTGGAGGAAAGAGAAGGAGGGCAGTGCTCCAGTGGTACAGAAGTGAGACATAATGGAATCAGGCTTCACCTCCAAGGACACCTATCTAAGCCATTTTAACCCTCGGGATTACCTAGAAAAATATTACAAGTTTGGTTCTAGGCACTCTGCAGAAAGCCAGATTCTTAAGCACCTTCTGAAAAATCTTTTCAAGATATTCTGCCTAGACGGTGTGAAGGGAGACCTGCTGATTGACATCGGCTCTGGCCCCACTATCTATCAGCTCCTCTCTGCTTGTGAATCCTTTAAGGAGATCGTCGTCACTGACTACTCAGACCAGAACCTGCAGGAGCTGGAGAAGTGGCTGAAGAAAGAGCCAGAGGCCT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yanyan Cui et al.
Molecular carcinogenesis, 59(8), 940-954 (2020-05-06)
Esophageal squamous cell carcinoma (ESCC) is a common malignant tumor with poor prognosis. And different individuals respond to the same drug differently. Increasing evidence has confirmed that metabolism reprogramming was involved in the drug sensitivity of tumor cells. However, the
Yanzhong Wang et al.
Breast cancer research : BCR, 21(1), 64-64 (2019-05-19)
Nicotinamide N-methyltransferase (NNMT) is overexpressed in various human tumors and involved in the development and progression of several carcinomas. In breast cancer, NNMT was found to be overexpressed in several cell lines. However, the clinical relevance of NNMT in breast
Yanyan Cui et al.
Molecular and cellular biochemistry, 460(1-2), 93-103 (2019-07-07)
Nicotinamide N-methyltransferase (NNMT) is an important methyltransferase involved in the biotransformation of many drugs and exogenous compounds. Abnormal expression of NNMT protein is closely associated with the onset and progression of many malignancies, but little is known about its role
Bashar M Thejer et al.
BMC molecular and cell biology, 21(1), 26-26 (2020-04-16)
Progesterone receptor membrane component 1 (PGRMC1) is often elevated in cancers, and exists in alternative states of phosphorylation. A motif centered on PGRMC1 Y180 was evolutionarily acquired concurrently with the embryological gastrulation organizer that orchestrates vertebrate tissue differentiation. Here, we

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.