콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU036561

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF20

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AAAATGGCTGATGAGGATGCCTTGAGGAAGATCCGGGCAGTGGAGGAGCAGATAGAATACCTACAGAAGAAGCTAGCCATGGCCAAGCAGGAAGAAGAAGCACTCCTCTCTGAAATGGATGTCACAGGCCAGGCCTTTGAAGACATGCAGGAGCAAAATATCCGTTTGATGCAGCAATTGCGGGAGAAGGATGATGCAAATTTCAAGCTCATGTCAGAGCGTATCAAGTCCAATCAGATCCATAAGTTGCTTAAAGAAGAGAAGGAGGAGCTGGCAGACCAGGTGTTGACTCTGAAGACTCAGGTTGATGCCCAGCTACAGGTAGTAAGGAAACTGGAAGAGAAGGAGCATCTGTTACAGAGCAACATTGGCACAGGGGAGAAAGAGCTGGGTCTTAGGACCCAAGCCTTAGAGATGAATAAACGCAAGGCAATGGAGGCAGCCCAGCTTGCAGATGACCTCAAAGCACA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jagmohan Hooda et al.
Cancer research, 79(4), 760-772 (2018-12-20)
Recent insights supporting the fallopian tube epithelium (FTE) and serous tubal intraepithelial carcinomas (STIC) as the tissue of origin and the precursor lesion, respectively, for the majority of high-grade serous ovarian carcinomas (HGSOC) provide the necessary context to study the
Danping Wang et al.
Frontiers in oncology, 10, 613470-613470 (2020-12-29)
E-cadherin, a hallmark of epithelial-mesenchymal transition (EMT), is often repressed due to Snail-mediated epigenetic modification; however, the exact mechanism remains unclear. There is an urgent need to understand the determinants of tumor aggressiveness and identify potential therapeutic targets in breast
Z-X Wang et al.
European review for medical and pharmacological sciences, 24(19), 9981-9989 (2020-10-23)
To explore the clinical significance of circRNF20 in non-small-cell lung carcinoma (NSCLC), and its regulatory effects on NSCLC cell functions by activating MAPK9. Relative levels of circRNF20 and MAPK9 in NSCLC tissues were detected by quantitative Real Time-Polymerase Chain Reaction

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.