콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU032851

Sigma-Aldrich

MISSION® esiRNA

targeting human CBL

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CATCCTGGCTACATGGCTTTTTTGACGTATGACGAAGTGAAAGCTCGGCTCCAGAAATTCATTCACAAACCTGGCAGTTATATCTTCCGGCTGAGCTGTACTCGTCTGGGTCAGTGGGCTATTGGGTATGTTACTGCTGATGGGAACATTCTCCAGACAATCCCTCACAATAAACCTCTCTTCCAAGCACTGATTGATGGCTTCAGGGAAGGCTTCTATTTGTTTCCTGATGGACGAAATCAGAATCCTGATCTGACTGGCTTATGTGAACCAACTCCCCAAGACCATATCAAAGTGACCCAGGAACAATATGAATTATACTGTGAGATGGGCTCCACATTCCAACTATGTAAAATATGTGCTGAAAATGATAAGGATGTAAAGATTGAGCCCTGTGGACACCTCATGTGCACATCCTGTCTTACATCCTGGCAGGAATCAGAAGGTCAGGGCTGTCCTTTCTGCCGATGTGAAAT

Ensembl | 인체 수납 번호

ENSG00000110395

NCBI 수납 번호

NM_005188

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CBL(867) , CBL(867)

관련 카테고리

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Ying Hong et al.
Neurology. Genetics, 6(4), e448-e448 (2020-07-09)
To report a series of patients with cerebral arteriopathy associated with heterozygous variants in the casitas B-lineage lymphoma (CBL) gene and examine the functional role of the identified mutant Cbl protein. We hypothesized that mutated Cbl fails to act as
Shimei Chen et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 132, 110856-110856 (2020-10-31)
The incidence of retinopathy of prematurity (ROP) has increased continuously in recent years. However, the therapeutic effects of current treatments still remain undesired. This study aims to investigate the role of C-CBL in retinal angiogenesis in ROP and its potential
Chia-Hao Chang et al.
Oncotarget, 8(19), 31199-31214 (2017-04-19)
Post-translational mechanisms regulating cell-matrix adhesion turnover during cell locomotion are not fully elucidated. In this study, we uncovered an essential role of Y118 site-specific tyrosine phosphorylation of paxillin, an adapter protein of focal adhesion complexes, in paxillin recruitment to autophagosomes
Chirayu Pandya et al.
Psychoneuroendocrinology, 45, 108-118 (2014-05-23)
Brain derived neurotrophic factor (BDNF) signaling through its receptor TrkB plays a crucial role in neurodevelopment and plasticity. Stress and glucocorticoids have been shown to alter TrkB signaling in neurons, and defects in TrkB expression have been reported in the
Y Gui et al.
Oncogene, 34(46), 5718-5728 (2015-03-03)
Suppressor of cytokine signaling 1 (SOCS1) is considered as a tumor suppressor protein in hepatocellular carcinoma (HCC), but the underlying mechanisms remain unclear. Previously, we have shown that SOCS1-deficient hepatocytes displayed increased responsiveness to hepatocyte growth factor (HGF) due to

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.