생물학적 소스
rabbit
Quality Level
결합
unconjugated
항체 형태
IgG fraction of antiserum
항체 생산 유형
primary antibodies
클론
polyclonal
형태
buffered aqueous solution
분자량
18 kDa
종 반응성
mouse, human, dog, bovine, horse, rat, guinea pig, rabbit
농도
0.5 mg - 1 mg/mL
기술
western blot: suitable
NCBI 수납 번호
UniProt 수납 번호
배송 상태
wet ice
저장 온도
−20°C
유전자 정보
human ... MAFF(23764)
면역원
Synthetic peptide directed towards the N terminal region of human MAFF
생화학적/생리학적 작용
MAFF is a basic leucine zipper transcription factor that binds to the promoter of oxytocin receptor gene. It lacks a transactivation domain but forms a homodimer that can repress transcription. MAFF reportedly regulates the gene expression in response to proinflammatory cytokines in myometrial cells.
서열
Synthetic peptide located within the following region: SVRELNRHLRGLSAEEVTRLKQRRRTLKNRGYAASCRVKRVCQKEELQKQ
물리적 형태
Purified antibody supplied in 1x PBS buffer with 0.09% (w/v) sodium azide and 2% sucrose.
면책조항
Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals.
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
WGK
WGK 1
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
T Kimura et al.
Biochemical and biophysical research communications, 264(1), 86-92 (1999-10-21)
The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term
Daniel N Itzhak et al.
Disease models & mechanisms, 12(11) (2019-10-20)
The unfolded protein response (UPR) involves extensive proteome remodeling in many cellular compartments. To date, a comprehensive analysis of the UPR has not been possible because of technological limitations. Here, we employ stable isotope labeling with amino acids in cell
Wael Massrieh et al.
Biology of reproduction, 74(4), 699-705 (2005-12-24)
The MAF (proto-)oncogene family of basic-leucine zipper transcription factors plays crucial roles in the control of mammalian gene expression and development. Here we analyzed the regulation of the human MAFF gene, coding for a small MAF transcription factor, in uterine
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.