Skip to Content
MilliporeSigma
All Photos(2)

Key Documents

OGS382

Sigma-Aldrich

PSF-CMV-RSV-ZEO ASCI - RSV PROMOTER ZEOCIN PLASMID

plasmid vector for molecular cloning

Synonym(s):

cloning vector, expression vector, molecular cloning vector, plasmid, plasmid vector, snapfast vector, vector

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$211.00
50 μG
$377.00

$211.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$211.00
50 μG
$377.00

About This Item

UNSPSC Code:
12352200
NACRES:
NA.85

$211.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

form

buffered aqueous solution

mol wt

size 5170 bp

bacteria selection

kanamycin

mammalian cells selection

Zeocin®

Origin of replication

pUC (500 copies)

Peptide cleavage

no cleavage

Promoter

Promoter name: CMV
Promoter activity: constitutive
Promoter type: mammalian

reporter gene

none

shipped in

ambient

storage temp.

−20°C

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU903961EMU147591EHU031881
esiRNA cDNA target sequence

CACGAACCCCAGACCTGTTTGTATCATCCGGGCTCCTTCCGGGCAGAAACAACTGAAAATGCACTTCAGACCCACTTATTTCTGCCACATCTGAGTCGGCCTGAGATAGACTTTTCCCTCTAAACTGGGAGAATATCACAGTGGTTTTTGTTAGCAGAAAATGCACTCCAGCCTCTGTACTCATCTAAGCTGCTTATTTTTGATATTTGTGTCAGTCTGTAAATGGATACTTCACTTTAATAACTGTTGCTTAGTAATTGGCTTTGTAGAGAAGCTGGAAAAAAATGGTTTTGTCTTCAACTCCTTTGCATGCCAGG

esiRNA cDNA target sequence

GCGTGCGCACCTTCCTGTCCTAGGCCAGGTGCCATGGCCGGCCAGGTGGGCTGCAGAGTGGGCTCCCTGCCCCTCTCTGCCTGTTCTGGACTGTGTTCTGGGCCTGCTGAGGATGGCAGAGCTGGTGTCCATCCAGCACTGACCAGCCCTGATTCCCCGACCACCGCCCAGGGTGGAGAAGGAGGCCCTTGCTTGGCGTGGGGGATGGCTTAACTGTACCTGTTTGGATGCTTCTGAATAGAAATAAAGTGGGTTTTCCCTGGAGGT

esiRNA cDNA target sequence

GAAGGCTGCGGATCAACAATCAGGCGCCTCTGCTTCCAGGGCGCCGGGGGCCTGACTCGGTGGTGAGTGCGGCTGCCTTCGTCAGGACGGGCGAGCGTGGCTCTCGACGGCTGGGCGGGCTAGCTGACTCCTCCTTCGGCCCGGAAGGCAGTTCTCAGGGCCGCCCGACCCCCGCTCCCTGCCTAAGTCCTTGGGCTTGGACTTGTATAACAGTTTTGCTTTCTTTTCCTTTCGGTTTATTTTTTCAGTCAACCCAGGCTAGTCTCGAATTTGCGGCAATCCTCCTGCCTCCAATCGTTCTAGGTGCTGGGATTACTGGTGTGCAGCACCTCGGCTGTCTCTTCAGATTTTCTGCAGGTT

esiRNA cDNA target sequence

TGGGAGTGACAGATGATGGAGAAGGAAGTCATATTCTTCAATCTCCATCAGCCAATGTGCTTCCAACCCTTCCTTTCCACGTCCTTCGTAGCTTGTTTAGCACTACACCTTTGACAACTGATGATGGTGTACTTCTAAGGCGGATGGCATTGGAAATTGGAGCCTTACACCTCATTCTTGTCTGTCTCTCTGCTTTGAGCCACCATTCCCCACGAGTTCCAAACTCTAGCGTGAATCAAACTGAGCCACAGGTGTCAAGCTCTCATAACCCTACATCAACAGAAGAACAACAGTTATATTGGGCCAAAGGGACTGGCTTTGGAACAGGCTCTACAGCTTCTGGGTGGGATGTGGAACAAGCCTTAACTAAGCAAAGGCTGGAAGAGGAACATGTTACCTGCCTTCTGCAGGTT

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

form

lyophilized, lyophilized powder

form

lyophilized, lyophilized powder

form

lyophilized powder

form

lyophilized powder

shipped in

ambient

shipped in

ambient

shipped in

ambient

shipped in

ambient

General description

This vector contains a zeocin (Zeo) resistance expression cassette that is designed as an add-on to any of our vectors. The entire RSV Zeo expression cassette is flanked by AscI sites. The RSV promoter is considerably weaker than CMV. We have a stronger Ubiquitin promoter driven vector (pSF-CMV-Ub-Zeo AscI) in the same format if you require high levels of reporter gene activity.

Promoter Expression Level: This plasmid contains the mammalian CMV promoter to drive gene expression. We have tested all of our mammalian promoters in a range of cell types and CMV is consistently the strongest in those we have studied. However there are many reports of the CMV promoter demonstrating silencing by methylation in long-term culture.

Application

Cloning in a gene: This plasmid has been designed to be compatible with a range of cloning techniques. The multiple cloning site contains a range of standard commonly used restriction sites for cloning. Using these sites genes can be inserted using standard cloning methods with DNA ligase. Other methods such as ligase independent cloning (LIC) Gibson Assembly InFusionHD or Seamless GeneArt can also be used and because all of our plasmids are based on the same backbone the same method can be used for cloning into all of our catalogue vectors.

Multiple cloning site notes: There are a few important sites within the MCS. These include the NcoI site the XbaI site and the BsgI and BseRI sites. The NcoI site contains a start codon that is immediately downstream of both a Kozak and Shine-Dalgarno ribosomal binding site. These allow for optimal positioning of genes when the start codon is placed in this location. If this is not required and you wish to use a downstream site for gene cloning you can remove the NcoI site by cleaving the plasmid with KpnI.

The XbaI site contains a stop codon. This stop codon is positioned in a specific position in relation to the BsgI and BseRI sites that are immediately downstream. When either BseRI or BsgI cleave the plasmid they produce a TA overhang from the stop codon in the XbaI site that is compatible with all of our peptide tag plasmids cut with the same sites. BseRI and BsgI sites are non-palindromic and cleave a defined number of bases away from their binding site.

Whenever we clone a gene into our multiple cloning site we always position the start and stop codon in the same positions in the MCS. If the start and ends of the genes are not compatible with NcoI and XbaI we extend the sequence to the nearest external sites but keep the start and stop codons locations consistent.

Sequence

To view sequence information for this product, please visit the product page

Analysis Note

To view the Certificate of Analysis for this product, please visit www.oxgene.com

Legal Information

Zeocin is a registered trademark of Cayla Sarl

related product

Product No.
Description
Pricing

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Geoffrey M Lynn et al.
Nature biotechnology, 33(11), 1201-1210 (2015-10-27)
The efficacy of vaccine adjuvants such as Toll-like receptor agonists (TLRa) can be improved through formulation and delivery approaches. Here, we attached small molecule TLR-7/8a to polymer scaffolds (polymer-TLR-7/8a) and evaluated how different physicochemical properties of the TLR-7/8a and polymer
Diana Romero et al.
Carcinogenesis, 37(1), 18-29 (2015-10-28)
Dickkopf-3 (Dkk-3) is a secreted protein whose expression is downregulated in many types of cancer. Endogenous Dkk-3 is required for formation of acini in 3D cultures of prostate epithelial cells, where it inhibits transforming growth factor (TGF)-β/Smad signaling. Here, we
Alexander C Cerny et al.
PLoS genetics, 11(10), e1005578-e1005578 (2015-10-29)
Recycling of signaling proteins is a common phenomenon in diverse signaling pathways. In photoreceptors of Drosophila, light absorption by rhodopsin triggers a phospholipase Cβ-mediated opening of the ion channels transient receptor potential (TRP) and TRP-like (TRPL) and generates the visual
Jin-Gyoung Jung et al.
PLoS genetics, 10(10), e1004751-e1004751 (2014-10-31)
The Notch3 signaling pathway is thought to play a critical role in cancer development, as evidenced by the Notch3 amplification and rearrangement observed in human cancers. However, the molecular mechanism by which Notch3 signaling contributes to tumorigenesis is largely unknown.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service