Skip to Content
Merck
All Photos(1)

Documents

Safety Information

EHU031291

Sigma-Aldrich

MISSION® esiRNA

targeting human DKC1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTGTGCACCTTGGTTTGTTATTGGGAGTTGGTGGTCAGATGCAGGAGCTTCGGAGGGTTCGTTCTGGAGTCATGAGTGAAAAGGACCACATGGTGACAATGCATGATGTGCTTGATGCTCAGTGGCTGTATGATAACCACAAGGATGAGAGTTACCTGCGGCGAGTTGTTTACCCTTTGGAAAAGCTGTTGACATCTCATAAACGGCTGGTTATGAAAGACAGTGCAGTAAATGCCATCTGCTATGGGGCCAAGATTATGCTTCCAGGTGTTCTTCGATATGAGGACGGCATTGAGGTCAATCAGGAGATTGTGGTTATCACCACCAAAGGAGAAGCAATCTGCATGGCTATTGCATTAATGACCACAGCGGTCATCTCTACCTGCGACCATGGTATAGTAGCCAAGATCAAGAGAGTGATCATGGAGAGAGACACTTACCCTCGGAAGTGGGGTTTAGGTCCAAAGGCAAGTCAGA

Ensembl | human accession no.

ENSG00000130826

NCBI accession no.

NM_001363

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DKC1(1736) , DKC1(1736)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Regulatory Listings

Regulatory Listings are mainly provided for chemical products. Only limited information can be provided here for non-chemical products. No entry means none of the components are listed. It is the user’s obligation to ensure the safe and legal use of the product.

JAN Code

EHU031291-50UG:
EHU031291-20UG:

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Vahid Khoddami et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(14), 6784-6789 (2019-03-16)
The breadth and importance of RNA modifications are growing rapidly as modified ribonucleotides can impact the sequence, structure, function, stability, and fate of RNAs and their interactions with other molecules. Therefore, knowing cellular RNA modifications at single-base resolution could provide
Khloud A Elsharawy et al.
British journal of cancer, 123(10), 1543-1552 (2020-09-02)
Hypertrophy of the nucleolus is a distinctive cytological feature of malignant cells and corresponds to aggressive behaviour. This study aimed to identify the key gene associated with nucleolar prominence (NP) in breast cancer (BC) and determine its prognostic significance. From
Nunzia Di Maio et al.
FEBS open bio, 7(10), 1453-1468 (2017-10-06)
Dyskerin is an essential, conserved, multifunctional protein found in the nucleolus, whose loss of function causes the rare genetic diseases X-linked dyskeratosis congenita and Hoyeraal-Hreidarsson syndrome. To further investigate the wide range of dyskerin's biological roles, we set up stable
Meng Zhang et al.
Oncology reports, 40(2), 968-978 (2018-06-15)
DKC1, an X‑linked gene encoding dyskerin at Xq28, is a crucial component of the telomerase complex and is indispensable for normal telomere function and the post‑-transcriptional modification of precursor rRNA. It has been revealed to exert diverse biological functions and
Pingfu Hou et al.
British journal of cancer, 122(5), 668-679 (2019-12-21)
Dyskeratosis congenita 1 (DKC1) is dysregulated in several cancers. However, the expression and function of DKC1 in colorectal cancer (CRC) is rarely reported. Tissue microarrays (TAMs) including 411 cases of CRC tissues and corresponding paracancerous tissues were used to examine
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service