Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU069661

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Becn1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGCCAATAAGATGGGTCTGAAGTTTCAGAGGTACCGACTTGTTCCCTATGGAAATCATTCCTATCTGGAGTCTCTGACAGACAAATCTAAGGAGTTGCCGTTATACTGTTCTGGGGGTTTGCGGTTTTTCTGGGACAACAAGTTTGACCATGCAATGGTAGCTTTTCTGGACTGTGTGCAGCAGTTCAAAGAAGAGGTGGAAAAAGGAGAGACTCGATTTTGTCTTCCGTACAGGATGGACGTGGAGAAAGGCAAGATTGAAGACACTGGAGGCAGTGGCGGCTCCTATTCCATCAAAACCCAGTTTAACTCGGAGGAGCAGTGGACAAAAGCGCTCAAGTTCATGCTGACCAATCTCAAGTGGGGTCTTGCCTGGGTGTCCTCACAGTTCTATAACAAGTGACTTGCTCCTTAGGGGATGTTTG

N° accesso Ensembl | topo

ENSMUSG00000035086

N° accesso NCBI

NM_019584

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... BECN1(56208) , Becn1(56208)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ge Niu et al.
The Journal of biological chemistry, 290(29), 18102-18110 (2015-06-10)
One of the fundamental functions of molecular chaperone proteins is to selectively conjugate cellular proteins, targeting them directly to lysosome. Some of chaperones, such as the stress-induced Hsp70, also play important roles in autophagosome-forming macroautophagy under various stress conditions. However
Yusra Al Dhaheri et al.
PloS one, 9(10), e109630-e109630 (2014-10-10)
In this study we investigated the in vitro and in vivo anticancer effect of carnosol, a naturally occurring polyphenol, in triple negative breast cancer. We found that carnosol significantly inhibited the viability and colony growth induced G2 arrest in the
Xing-guo Zhao et al.
PloS one, 10(4), e0126147-e0126147 (2015-04-30)
Hypopharyngeal squamous cell carcinoma (HSCC) has the worst prognosis among head and neck cancers. Cisplatin (DDP)-based chemotherapy is an important part of multimodal treatments. However, resistance to DDP severely impairs the effectiveness of chemotherapy for HSCC. Chloroquine (CQ) has been
Pujika Emani Munasinghe et al.
International journal of cardiology, 202, 13-20 (2015-09-20)
Diabetes promotes progressive loss of cardiac cells, which are replaced by a fibrotic matrix, resulting in the loss of cardiac function. In the current study we sought to identify if excessive autophagy plays a major role in inducing this progressive
Tiina Öhman et al.
Journal of immunology (Baltimore, Md. : 1950), 192(12), 5952-5962 (2014-05-09)
Dectin-1 is a membrane-bound pattern recognition receptor for β-glucans, which are the main constituents of fungal cell walls. Detection of β-glucans by dectin-1 triggers an effective innate immune response. In this study, we have used a systems biology approach to
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.