Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU077951

Sigma-Aldrich

MISSION® esiRNA

targeting human ARPC2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGATTTCGATGGGGTCCTCTATCATATTTCAAATCCTAATGGAGACAAAACAAAAGTGATGGTCAGTATTTCTTTGAAATTCTACAAGGAACTTCAGGCACATGGTGCTGATGAGTTATTAAAGAGGGTGTACGGGAGTTTCTTGGTAAATCCAGAATCAGGATACAATGTCTCTTTGCTATATGACCTTGAAAATCTTCCGGCATCCAAGGATTCCATTGTGCATCAAGCTGGCATGTTGAAGCGAAATTGTTTTGCCTCTGTCTTTGAAAAATACTTCCAATTCCAAGAAGAGGGCAAGGAAGGAGAGAACAGGGCAGTTATCCATTATAGGGATGATGAGACCATGTATGTTGAGTCTAAAAAGGACAGAGTCACAGTAGTCTTCAGCACAGTGTTTAAGGATGACGACGATGTGGTCATTGGAAAGGTGTTCATGCAG

N° accesso Ensembl | uomo

ENSG00000163466

N° accesso NCBI

NM_005731

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... ARPC2(10109) , ARPC2(10109)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yae Jin Yoon et al.
Biochemical pharmacology, 163, 46-59 (2019-02-03)
Metastasis is the leading cause of cancer mortality and cancer cell migration is an essential stage of metastasis. We identified benproperine (Benp, a clinically used antitussive drug) as an inhibitor of cancer cell migration and an anti-metastatic agent. Benp selectively
Zhongle Cheng et al.
Oncology reports, 41(6), 3189-3200 (2019-04-20)
Actin-related protein 2/3 complex (ARPC2) is an actin‑binding component involved in the regulation of actin polymerization. It mediates the formation of branched actin networks and contacts the mother actin filament. Migration and invasion are key processes which enable tumor cells
Aleksandra S Chikina et al.
Biology of the cell, 111(10), 245-261 (2019-08-14)
Metastatic disease is caused by the ability of cancer cells to reach distant organs and form secondary lesions at new locations. Dissemination of cancer cells depends on their migration plasticity - an ability to switch between motility modes driven by

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.