Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU074901

Sigma-Aldrich

MISSION® esiRNA

targeting human CBLB

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGCTCTCCAAAACCTGGAATCACAGCGAGTTCAAATGTCAATGGAAGGCACAGTAGAGTGGGCTCTGACCCAGTGCTTATGCGGAAACACAGACGCCATGATTTGCCTTTAGAAGGAGCTAAGGTCTTTTCCAATGGTCACCTTGGAAGTGAAGAATATGATGTTCCTCCCCGGCTTTCTCCTCCTCCTCCAGTTACCACCCTCCTCCCTAGCATAAAGTGTACTGGTCCGTTAGCAAATTCTCTTTCAGAGAAAACAAGAGACCCAGTAGAGGAAGATGATGATGAATACAAGATTCCTTCATCCCACCCTGTTTCCCTGAATTCACAACCATCTCATTGTCATAATGTAAAACCTCCTGTTCGGTCTTGTGATAATGGTCACTGTATGCTGAATGGAACACATGGT

N° accesso Ensembl | uomo

ENSG00000114423

N° accesso NCBI

NM_170662

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CBLB(868) , CBLB(868)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Juan Tang et al.
The Journal of experimental medicine, 217(4) (2020-01-31)
Aberrant NLRP3 inflammasome activation contributes to the development of endotoxemia. The importance of negative regulation of NLRP3 inflammasomes remains poorly understood. Here, we show that the E3 ubiquitin ligase Cbl-b is essential for preventing endotoxemia induced by a sub-lethal dose
Noah Joseph et al.
FEBS letters, 588(21), 3808-3815 (2014-09-15)
The Nck adapter protein is involved in key cellular functions, such as actin polymerization and reorganization, serving as a molecular bridge between the surface complex essential for foreign antigen recognition, the T-cell antigen receptor (TCR), and the actin machinery. However
Wei-Xia Yang et al.
FEBS letters, 589(15), 1975-1980 (2015-06-27)
Orosomucoid 1-Like Protein 3 (ORMDL3) is an asthma candidate gene and Casitas B lineage lymphoma b (Cbl-b), an E3 ubiquitin ligase, is a critical factor in maintaining airway immune tolerance. However, the association of Cbl-b with ORMDL3 for asthma is
Yubo Cao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(7), 5607-5615 (2015-02-24)
Mammalian target of rapamycin (mTOR) has emerged as a new potential therapeutic target for gastric cancer. However, a phase III clinical trial found that monotherapy with the mTOR inhibitor everolimus did not significantly improve the overall survival of patients with

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.