Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU070021

Sigma-Aldrich

MISSION® esiRNA

targeting human TFAP2A

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTGTCCAAGTCCAACAGCAATGCCGTCTCCGCCATCCCTATTAACAAGGACAACCTCTTCGGCGGCGTGGTGAACCCCAACGAAGTCTTCTGTTCAGTTCCGGGTCGCCTCTCGCTCCTCAGCTCCACCTCGAAGTACAAGGTCACGGTGGCGGAAGTGCAGCGGCGGCTCTCACCACCCGAGTGTCTCAACGCGTCGCTGCTGGGCGGAGTGCTCCGGAGGGCGAAGTCTAAAAATGGAGGAAGATCTTTAAGAGAAAAACTGGACAAAATAGGATTAAATCTGCCTGCAGGGAGACGTAAAGCTGCCAACGTTACCCTGCTCACATCACTAGTAGAGGGAGAAGCTGTCCACCTAGCCAGGGACTTTGGGTACGTGTGCGAAACCGAATTTCCTGCCAAAGCAGTAGCT

N° accesso Ensembl | uomo

ENSG00000137203

N° accesso NCBI

NM_001042425

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... TFAP2A(7020) , TFAP2A(7020)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Liesbeth Minnoye et al.
Genome research, 30(12), 1815-1834 (2020-08-01)
Deciphering the genomic regulatory code of enhancers is a key challenge in biology because this code underlies cellular identity. A better understanding of how enhancers work will improve the interpretation of noncoding genome variation and empower the generation of cell
Fuchao Zhang et al.
Neurochemical research, 44(12), 2776-2785 (2019-10-28)
Transcription factors regulate the transcriptions and expressions of numerous target genes and direct a variety of physiological and pathological activities. To obtain a better understanding of the involvement of transcription factors during peripheral nerve repair and regeneration, significantly differentially expressed
Xiaoning Wang et al.
Molecular genetics & genomic medicine, 8(1), e1025-e1025 (2019-11-09)
Preeclampsia (PE) is a common pregnancy-related syndrome characterized by hypertension and proteinuria, and a major cause of maternal mortality. Therefore, there is an urgent need to identify early biomarkers of PE. The aim of the present study was to identify
Bishuang Gong et al.
Molecular immunology, 122, 173-185 (2020-05-07)
Thymic epithelial cells (TECs) are essential regulators of T cell development and selection. microRNAs (miRNAs) play critical roles in regulating TECs proliferation during thymus involution. miR-205-5p is highly expressed in TECs and increases with age. However, the function and potential
Cameron C Scott et al.
eLife, 7 (2018-09-27)
How trafficking pathways and organelle abundance adapt in response to metabolic and physiological changes is still mysterious, although a few transcriptional regulators of organellar biogenesis have been identified in recent years. We previously found that the Wnt signaling directly controls

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.