Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU052661

Sigma-Aldrich

MISSION® esiRNA

targeting human CSF1R

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGGAGGCGTCGACTATAAGAACATCCACCTCGAGAAGAAATATGTCCGCAGGGACAGTGGCTTCTCCAGCCAGGGTGTGGACACCTATGTGGAGATGAGGCCTGTCTCCACTTCTTCAAATGACTCCTTCTCTGAGCAAGACCTGGACAAGGAGGATGGACGGCCCCTGGAGCTCCGGGACCTGCTTCACTTCTCCAGCCAAGTAGCCCAGGGCATGGCCTTCCTCGCTTCCAAGAATTGCATCCACCGGGACGTGGCAGCGCGTAACGTGCTGTTGACCAATGGTCATGTGGCCAAGATTGGGGACTTCGGGCTGGCTAGGGACATCATGAATGACTCCAACTACATTGTCAAGGGCAATGCCCGCCTGCCTGTGAAGTGGATGGCCCCAGAGAGCATCTTTGACTGTGTCTACACGGTTCAGAGCGACGTCTGGTCCTATGGCATCCTC

N° accesso Ensembl | uomo

ENSG00000182578

N° accesso NCBI

NM_005211

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CSF1R(1436) , CSF1R(1436)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ladonya Jackson et al.
Journal of neuroinflammation, 17(1), 137-137 (2020-04-30)
Unfortunately, over 40% of stroke victims have pre-existing diabetes which not only increases their risk of stroke up to 2-6 fold, but also worsens both functional recovery and the severity of cognitive impairment. Our lab has recently linked the chronic
Thidarath Rattanaburee et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 129, 110361-110361 (2020-06-15)
Kusunokinin, a lignan compound, inhibits cancer cell proliferation and induces apoptosis; however, the role of kusunokinin is not fully understood. Here, we aimed to identify a target protein of (-)-kusunokinin and determine the protein levels of its downstream molecules. We
Xiaolong Shi et al.
Cellular and molecular gastroenterology and hepatology, 10(2), 391-418 (2020-04-19)
The miR-34a gene is a direct target of p53 and is commonly silenced in colorectal cancer (CRC). Here we identified the receptor tyrosine kinase CSF1R as a direct miR-34a target and characterized CSF1R as an effector of p53/miR-34a-mediated CRC suppression.
Qiang Chen et al.
Fish & shellfish immunology, 45(2), 386-398 (2015-05-10)
Colony-stimulating factor 1 receptor (CSF1R) is an important regulator of monocytes/macrophages (MO/MΦ). Although CSF1R gene has been identified and functionally studied in many fish, the precise role of CSF1R in grass carp (Ctenopharyngodon idellus) remains unclear. In this study, we

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.