Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU024791

Sigma-Aldrich

MISSION® esiRNA

targeting human TET2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGCAGCAGCCAATAGGACATGATCCAGGAAGAGCAGTAAGGGACTGAGCTGCTGAATTCAACTAGAGGGCAGCCTTGTGGATGGCCCCGAAGCAAGCCTGATGGAACAGGATAGAACCAACCATGTTGAGGGCAACAGACTAAGTCCATTCCTGATACCATCACCTCCCATTTGCCAGACAGAACCTCTGGCTACAAAGCTCCAGAATGGAAGCCCACTGCCTGAGAGAGCTCATCCAGAAGTAAATGGAGACACCAAGTGGCACTCTTTCAAAAGTTATTATGGAATACCCTGTATGAAGGGAAGCCAGAATAGTCGTGTGAGTCCTGACTTTACACAAGAAAGTAGAGGGTATTCCAAGTGTTTGCAAAATGGAGGAATAAAACGCACAGTTAGTGAACCTTCTCTCTCTGGGCTCC

N° accesso Ensembl | uomo

ENSG00000168769

N° accesso NCBI

NM_017628

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... TET2(54790) , TET2(54790)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Elena F M Manzoni et al.
Scientific reports, 6, 37017-37017 (2016-11-15)
Phenotype definition is controlled by epigenetic regulations that allow cells to acquire their differentiated state. The process is reversible and attractive for therapeutic intervention and for the reactivation of hypermethylated pluripotency genes that facilitate transition to a higher plasticity state.
Xixia Zhang et al.
Cancer cell international, 20, 363-363 (2020-08-11)
Nasopharyngeal carcinoma (NPC) is a common malignant tumor. Ten-eleven translocation (TET) protein 2 (TET2), an evolutionarily conserved dioxygenases, is reported to be involved in various malignant tumor developments. Here, we aim to investigate the effect of TET2 on NPC progress
Juan Peng et al.
Oncotarget, 7(47), 76423-76436 (2016-11-09)
Tet methylcytosine dioxygenase 2 (TET2) mediates the conversion of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC). The loss of TET2 is associated with advanced atherosclerotic lesions. Our previous study showed that TET2 improves endothelial cell function by enhancing endothelial cell autophagy. Accordingly
Zhaocai He et al.
American journal of translational research, 10(10), 3211-3223 (2018-11-13)
To explore the effect of fetal-lethal non-coding developmental regulatory RNA (FENDRR) in the initiation and progression of gastric cancer (GC). We detected the levels of FENDRR, microRNA-214-3p (miR-214-3p), and ten-eleven-translocation (TET2) in GC tissues and GC cell lines. In addition
Peter A Mollica et al.
Journal of cell science, 131(13) (2018-06-15)
Huntington's disease (HD) is a rare autosomal dominant neurodegenerative disorder caused by a cytosine-adenine-guanine (CAG) trinucleotide repeat (TNR) expansion within the HTT gene. The mechanisms underlying HD-associated cellular dysfunction in pluripotency and neurodevelopment are poorly understood. We had previously identified
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.