Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU015991

Sigma-Aldrich

MISSION® esiRNA

targeting human SSRP1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCCAAACTCGCTACCACTTCCTGATCCTCCTCTTCTCCAAGGACGAGGACATTTCGTTGACTCTGAACATGAACGAGGAAGAAGTGGAGAAGCGCTTTGAGGGTCGGCTCACCAAGAACATGTCAGGATCCCTCTATGAGATGGTCAGCCGGGTCATGAAAGCACTGGTAAACCGCAAGATCACAGTGCCAGGCAACTTCCAAGGGCACTCAGGGGCCCAGTGCATTACCTGTTCCTACAAGGCAAGCTCAGGACTGCTCTACCCGCTGGAGCGGGGCTTCATCTACGTCCACAAGCCACCTGTGCACATCCGCTTCGATGAGATCTCCTTTGTCAACTTTGCTCGTGGTACCACTACTACTCGTTCCTTTGACTTTGAAATTGAGACCAAGCAGGGCACTCAGTATACCTTCAGCAGCATTGAGAGGGAGGAGTACGGGAAACTGTTTGATTTTGTCAACGCGAAAAAGCTCAACATCAAAAACCGAGGATTGAAAGAGGGCATGAA

N° accesso Ensembl | uomo

ENSG00000149136

N° accesso NCBI

NM_003146

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SSRP1(6749) , SSRP1(6749)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
YDV
FAV
RXU
SWU
BWU

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wenyong Long et al.
Journal of molecular cell biology, 10(2), 147-160 (2018-02-17)
The differentiation status of neuroblastoma (NB) strongly correlates with its clinical outcomes; however, the molecular mechanisms driving maintenance of stemness and differentiation remain poorly understood. Here, we show that plant homeodomain finger-containing protein 20 (PHF20) functions as a critical epigenetic
Alan S Wang et al.
Molecular cell, 79(2), 221-233 (2020-07-01)
Cas9 is a prokaryotic RNA-guided DNA endonuclease that binds substrates tightly in vitro but turns over rapidly when used to manipulate genomes in eukaryotic cells. Little is known about the factors responsible for dislodging Cas9 or how they influence genome engineering.
Miranda M Tallman et al.
Cancer letters, 499, 232-242 (2020-12-01)
Glioblastoma (GBM) is an incurable brain tumor with inevitable recurrence. This is in part due to a highly malignant cancer stem cell (CSC) subpopulation of tumor cells that is particularly resistant to conventional treatments, including radiotherapy. Here we show that
Ying Gao et al.
Cancer research, 77(10), 2674-2685 (2017-04-19)
DNA single-strand breaks (SSB) are the most common form of DNA damage, requiring repair processes that to initiate must overcome chromatin barriers. The FACT complex comprised of the SSRP1 and SPT16 proteins is important for maintaining chromatin integrity, with SSRP1
Ling Bi et al.
International journal of cancer, 145(1), 164-178 (2018-12-15)
Cancer cell repopulation through cell cycle re-entry by quiescent (G0 ) cell is thought to be an important mechanism behind treatment failure and cancer recurrence. Facilitates Chromatin Transcription (FACT) is involved in DNA repair, replication and transcription by eviction of

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.