Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

AV38984

Sigma-Aldrich

Anti-MAFF antibody produced in rabbit

IgG fraction of antiserum

Sinonimo/i:

Anti-v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
12352203
NACRES:
NA.41

Origine biologica

rabbit

Livello qualitativo

Coniugato

unconjugated

Forma dell’anticorpo

IgG fraction of antiserum

Tipo di anticorpo

primary antibodies

Clone

polyclonal

Stato

buffered aqueous solution

PM

18 kDa

Reattività contro le specie

mouse, human, dog, bovine, horse, rat, guinea pig, rabbit

Concentrazione

0.5 mg - 1 mg/mL

tecniche

western blot: suitable

N° accesso NCBI

N° accesso UniProt

Condizioni di spedizione

wet ice

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MAFF(23764)

Immunogeno

Synthetic peptide directed towards the N terminal region of human MAFF

Azioni biochim/fisiol

MAFF is a basic leucine zipper transcription factor that binds to the promoter of oxytocin receptor gene. It lacks a transactivation domain but forms a homodimer that can repress transcription. MAFF reportedly regulates the gene expression in response to proinflammatory cytokines in myometrial cells.

Sequenza

Synthetic peptide located within the following region: SVRELNRHLRGLSAEEVTRLKQRRRTLKNRGYAASCRVKRVCQKEELQKQ

Stato fisico

Purified antibody supplied in 1x PBS buffer with 0.09% (w/v) sodium azide and 2% sucrose.

Esclusione di responsabilità

Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals.

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Classe di pericolosità dell'acqua (WGK)

WGK 1

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

T Kimura et al.
Biochemical and biophysical research communications, 264(1), 86-92 (1999-10-21)
The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term
Daniel N Itzhak et al.
Disease models & mechanisms, 12(11) (2019-10-20)
The unfolded protein response (UPR) involves extensive proteome remodeling in many cellular compartments. To date, a comprehensive analysis of the UPR has not been possible because of technological limitations. Here, we employ stable isotope labeling with amino acids in cell
Wael Massrieh et al.
Biology of reproduction, 74(4), 699-705 (2005-12-24)
The MAF (proto-)oncogene family of basic-leucine zipper transcription factors plays crucial roles in the control of mammalian gene expression and development. Here we analyzed the regulation of the human MAFF gene, coding for a small MAF transcription factor, in uterine

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.