Skip to Content
Merck
All Photos(1)

Documents

EHU090641

Sigma-Aldrich

MISSION® esiRNA

targeting human RASAL2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGACTGGTCGCCAATTTGTAGAAAAGTGGTATCCAGTGAGTACACCTACACCCAACAAAGGAAAGACAGGAGGACCTTCTATTCGGATTAAATCACGTTTCCAAACTATCACCATTCTGCCTATGGAGCAATACAAAGAATTTGCAGAATTTGTCACCAGCAACTACACCATGCTGTGTTCTGTCCTTGAGCCAGTAATTAGTGTGAGAAATAAAGAGGAGTTGGCTTGTGCCTTAGTGCACATTCTTCAAAGTACTGGCAGAGCCAAGGATTTTCTGACTGACTTGGTGATGTCTGAGGTGGATCGTTGTGGAGAGCATGATGTCTTGATCTTCAGAGAGAACACTATTGCCACCAAATCCATTGAGGAATACCTCAAGTTGGTGGGACAACAGTATCTTCATGACGCACTGGGGGAGTTTATCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ke Hui et al.
Cell death & disease, 8(2), e2600-e2600 (2017-02-10)
Muscle-invasive or metastatic bladder cancer (BCa) is associated with a very poor prognosis, and the underlying mechanism remains poorly understood. In this study, we demonstrate RASAL2, a RAS GTPase-activating protein (RAS GAP), acts as a tumor suppressor in BCa. First
Libo Yin et al.
Molecular therapy oncolytics, 14, 74-81 (2019-05-03)
Pancreatic ductal adenocarcinoma (PDA) is one of the most lethal tumors, with poor therapeutic options in the advanced state. The broccoli-derived anti-inflammatory agent sulforaphane was shown to inhibit the progression of pancreatic cancer and other tumor entities. We examined the
Barbara Stefanska et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3118-3132 (2014-04-26)
We utilized whole-genome mapping of promoters that are activated by DNA hypomethylation in hepatocellular carcinoma (HCC) clinical samples to shortlist novel targets for anticancer therapeutics. We provide a proof of principle of this approach by testing six genes short-listed in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service