Skip to Content
Merck
All Photos(1)

Documents

EHU156861

Sigma-Aldrich

MISSION® esiRNA

targeting human IKZF1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGGAGCAGATGAAGGTGTACAAGTGCGAACACTGCCGGGTGCTCTTCCTGGATCACGTCATGTACACCATCCACATGGGCTGCCACGGCTTCCGTGATCCTTTTGAGTGCAACATGTGCGGCTACCACAGCCAGGACCGGTACGAGTTCTCGTCGCACATAACGCGAGGGGAGCACCGCTTCCACATGAGCTAAAGCCCTCCCGCGCCCCCACCCCAGACCCCGAGCCACCCCAGGAAAAGCACAAGGACTGCCGCCTTCTCGCTCCCGCCAGCAGCATAGACTGGACTGGACCAGACAATGTTGTGTTTGGATTTGTAACTGTTTTTTGTTTTTTGTTTGAGTTGGTTGATTGGGGTTTGATTTGCTTTTGAAAAGATTTTTATTTTTAGAGGCAGGGCTGCATTGGGAGCATCCAGAACTGCTACCTTCCTAGATGTTTCCCCAGACCGCTGGCTGAGATTCCCTCACCTGTCGCTTCCTAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ipsita Guha et al.
Frontiers in immunology, 11, 898-898 (2020-06-26)
Tumor progression in the host leads to severe impairment of intrathymic T-cell differentiation/maturation, leading to the paralysis of cellular anti-tumor immunity. Such suppression manifests the erosion of CD4+CD8+ double-positive (DP) immature thymocytes and a gradual increase in CD4-CD8- double negative
Maud Lemarié et al.
PLoS genetics, 17(3), e1009478-e1009478 (2021-03-27)
The tumor suppressor IKAROS binds and represses multiple NOTCH target genes. For their induction upon NOTCH signaling, IKAROS is removed and replaced by NOTCH Intracellular Domain (NICD)-associated proteins. However, IKAROS remains associated to other NOTCH activated genes upon signaling and
Nicholas A Vitanza et al.
Pediatric blood & cancer, 61(10), 1779-1785 (2014-07-01)
Ikaros, the product of IKZF1, is a regulator of lymphoid development and polymorphisms in the gene have been associated with the acute lymphoblastic leukemia (ALL). Additionally, IKZF1 deletions and mutations identify high-risk biological subsets of childhood ALL [Georgopoulos et al.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service