Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

Z720046

Millipore

Millipore® Ziptips

C18, rack of 96

Synonym(s):

pipet tips, pipette tips

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
$211.00
50 μG
$377.00

$211.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).


Select a Size

Change View
20 μG
$211.00
50 μG
$377.00

About This Item

UNSPSC Code:
41121500
NACRES:
NB.01

$211.00


Usually ships in 3 weeks (4 to 6 weeks for custom orders).

material

colorless tip

sterility

non-sterile

feature

barrier: no

packaging

rack of 96

manufacturer/tradename

Millipore ZTC18s960

volume range

0.1-10 μL

Looking for similar products? Visit Product Comparison Guide

Compare Similar Items

View Full Comparison

Show Differences

1 of 4

This Item
EHU903961EMU147591EHU031881
esiRNA cDNA target sequence

CACGAACCCCAGACCTGTTTGTATCATCCGGGCTCCTTCCGGGCAGAAACAACTGAAAATGCACTTCAGACCCACTTATTTCTGCCACATCTGAGTCGGCCTGAGATAGACTTTTCCCTCTAAACTGGGAGAATATCACAGTGGTTTTTGTTAGCAGAAAATGCACTCCAGCCTCTGTACTCATCTAAGCTGCTTATTTTTGATATTTGTGTCAGTCTGTAAATGGATACTTCACTTTAATAACTGTTGCTTAGTAATTGGCTTTGTAGAGAAGCTGGAAAAAAATGGTTTTGTCTTCAACTCCTTTGCATGCCAGG

esiRNA cDNA target sequence

GCGTGCGCACCTTCCTGTCCTAGGCCAGGTGCCATGGCCGGCCAGGTGGGCTGCAGAGTGGGCTCCCTGCCCCTCTCTGCCTGTTCTGGACTGTGTTCTGGGCCTGCTGAGGATGGCAGAGCTGGTGTCCATCCAGCACTGACCAGCCCTGATTCCCCGACCACCGCCCAGGGTGGAGAAGGAGGCCCTTGCTTGGCGTGGGGGATGGCTTAACTGTACCTGTTTGGATGCTTCTGAATAGAAATAAAGTGGGTTTTCCCTGGAGGT

esiRNA cDNA target sequence

GAAGGCTGCGGATCAACAATCAGGCGCCTCTGCTTCCAGGGCGCCGGGGGCCTGACTCGGTGGTGAGTGCGGCTGCCTTCGTCAGGACGGGCGAGCGTGGCTCTCGACGGCTGGGCGGGCTAGCTGACTCCTCCTTCGGCCCGGAAGGCAGTTCTCAGGGCCGCCCGACCCCCGCTCCCTGCCTAAGTCCTTGGGCTTGGACTTGTATAACAGTTTTGCTTTCTTTTCCTTTCGGTTTATTTTTTCAGTCAACCCAGGCTAGTCTCGAATTTGCGGCAATCCTCCTGCCTCCAATCGTTCTAGGTGCTGGGATTACTGGTGTGCAGCACCTCGGCTGTCTCTTCAGATTTTCTGCAGGTT

esiRNA cDNA target sequence

TGGGAGTGACAGATGATGGAGAAGGAAGTCATATTCTTCAATCTCCATCAGCCAATGTGCTTCCAACCCTTCCTTTCCACGTCCTTCGTAGCTTGTTTAGCACTACACCTTTGACAACTGATGATGGTGTACTTCTAAGGCGGATGGCATTGGAAATTGGAGCCTTACACCTCATTCTTGTCTGTCTCTCTGCTTTGAGCCACCATTCCCCACGAGTTCCAAACTCTAGCGTGAATCAAACTGAGCCACAGGTGTCAAGCTCTCATAACCCTACATCAACAGAAGAACAACAGTTATATTGGGCCAAAGGGACTGGCTTTGGAACAGGCTCTACAGCTTCTGGGTGGGATGTGGAACAAGCCTTAACTAAGCAAAGGCTGGAAGAGGAACATGTTACCTGCCTTCTGCAGGTT

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

storage temp.

−20°C

form

lyophilized, lyophilized powder

form

lyophilized, lyophilized powder

form

lyophilized powder

form

lyophilized powder

shipped in

ambient

shipped in

ambient

shipped in

ambient

shipped in

ambient

General description

Millipore ZipTips: Sample Preparation of Peptides or Proteins Prior to Electrospray/Nanoelectrospray MS

ZipTip Advantages:
  • Single-step desalting, concentration, and purification
  • Fractionate complex samples for more meaningful data
  • Ideal for peptides, proteins, nucleic acids, and more
  • No dead volume for maximum recovery
  • Eliminates time-consuming chromatography

Examples of analyses enhanced by ZipTip sample preparation:

  • Mass spectrometry
  • HPLC (high performance liquid chromatography)
  • Capillary electrophoresis
  • Atomic absorption spectroscopy

The ZipTip is a 10 μL (P-10) pipette tip with a bed of chromatography media fixed at its end such that there is no dead volume. It is intended for purifying and concentrating femtomoles to picomoles of protein, peptide or oligonucleotide samples prior to analysis, providing better data quality. The sample is aspirated and dispensed through ZipTip to bind, wash, and elute. Recovered samples are contaminant-free and eluted in 0.5-4 μL for direct transfer to a mass spectrometer target or vial.

ZipTip C18 is a 10 μL pipette tip with approximately a 0.6 μL bed of chromatography media fixed at its end such that there is no dead volume. ZipTip Micro-C18 is a 10 μL pipette tip with approximately a 0.2 μL bed of chromatography media fixed at its end such that there is no dead volume. Both are ideal for concentrating and purifying peptides, proteins or oligonucleotides in seconds prior to mass spectrometry, HPLC, capillary electrophoresis and other analytical techniques.

Legal Information

Millipore is a registered trademark of Merck KGaA, Darmstadt, Germany

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dae-Hee Lee et al.
Autophagy, 14(11), 1870-1885 (2018-07-07)
Macroautophagy is induced under various stresses to remove cytotoxic materials, including misfolded proteins and their aggregates. These protein cargoes are collected by specific autophagic receptors such as SQSTM1/p62 (sequestosome 1) and delivered to phagophores for lysosomal degradation. To date, little
Arman Kulyyassov et al.
Biomolecules, 10(1) (2020-01-23)
Protein-protein interactions of core pluripotency transcription factors play an important role during cell reprogramming. Cell identity is controlled by a trio of transcription factors: Sox2, Oct4, and Nanog. Thus, methods that help to quantify protein-protein interactions may be useful for

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service