Skip to Content
Merck
All Photos(1)

Documents

EMU034351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd34

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGTAGCTCTCTGCCTGATGAGTCTGCTGCATCTAAATAACTTGACTTCTGCTACCACGGAGACTTCTACACAAGGAATATCCCCATCAGTTCCTACCAATGAGTCTGTTGAGGAAAATATCACATCTAGCATCCCTGGAAGTACCAGCCACTACTTGATCTATCAGGACAGCAGTAAGACCACACCAGCCATCTCAGAGACTATGGTCAACTTTACAGTTACCTCTGGGATCCCTTCAGGCTCTGGAACTCCACACACTTTTTCACAACCACAGACTTCCCCAACTGGCATACTGCCTACTACTTCAGACAGTATTTCCACTTCAGAGATGACCTGGAAGTCCAGCCTGCCATCTATAAATGTTTCTGATTATTCGCCTAATAATAGCAGCTTTGAGATGACATCACCCACCGAGCCATATGCTTACACATCATCTTCTGCTCCGAGTGCCATTAAGGGAGAAATCAAATGCTCTGGAATCCG

Ensembl | mouse accession no.

ENSMUSG00000016494

NCBI accession no.

NM_133654

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... CD34(12490) , Cd34(12490)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tunay Kökten et al.
PloS one, 9(1), e86011-e86011 (2014-01-28)
The sensory innervation of the dental mesenchyme is essential for tooth function and protection. Sensory innervation of the dental pulp is mediated by axons originating from the trigeminal ganglia and is strictly regulated in time. Teeth can develop from cultured
Jun-Feng Liu et al.
Experimental and therapeutic medicine, 8(3), 805-812 (2014-08-15)
The number and function of endothelial progenitor cells (EPCs) may be a predictive factor for the severity and outcome of cardiovascular disease. However, the manipulation of bone marrow mononuclear cell (BMMC) cultures for EPCs is an elaborate and difficult procedure
Luisa Boldrin et al.
PLoS currents, 3, RRN1294-RRN1294 (2012-02-16)
Satellite cells, normally quiescent underneath the myofibre basal lamina, are skeletal muscle stem cells responsible for postnatal muscle growth, repair and regeneration. Since their scarcity and small size have limited study on transverse muscle sections, techniques to isolate individual myofibres
Rifat Jan et al.
Breast cancer research : BCR, 14(6), R146-R146 (2012-11-16)
Despite the benefits of endocrine therapies such as tamoxifen and aromatase inhibitors in treating estrogen receptor (ER) alpha-positive breast cancer, many tumors eventually become resistant. The molecular mechanisms governing resistance remain largely unknown. Pigment epithelium-derived factor (PEDF) is a multifunctional
Princess I Imoukhuede et al.
PloS one, 7(9), e44791-e44791 (2012-09-18)
VEGFR surface localization plays a critical role in converting extracellular VEGF signaling towards angiogenic outcomes, and the quantitative characterization of these parameters is critical for advancing computational models; however the levels of these receptors on blood vessels is currently unknown.
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service