Skip to Content
Merck
All Photos(1)

Documents

EHU064831

Sigma-Aldrich

MISSION® esiRNA

targeting human IFT88

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTATGAGAAGGCCGCTGAATTCTATAAAGAGGCTCTAAGAAATGATTCTTCTTGTACTGAAGCACTTTATAATATTGGCCTTACCTATGAGAAACTAAATCGGCTAGATGAGGCTTTGGACTGTTTCCTGAAACTTCACGCAATCCTACGAAACAGTGCCGAAGTTCTTTACCAGATAGCAAATATATATGAATTAATGGAAAATCCCAGTCAAGCTATTGAATGGCTAATGCAGGTGGTCAGTGTTATTCCAACCGATCCTCAAGTTTTATCTAAGCTAGGAGAATTATATGATCGTGAAGGAGATAAATCTCAAGCATTTCAATATTACTATGAGTCATATAGGTATTTTCCTTGTAATATTGAAGTCATTGAGTGGCTTGGAGCCTATTACATTGACACCCAATTTTGGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Taylor M Goldsmith et al.
Cell and tissue research, 380(1), 191-200 (2020-01-05)
Most mammalian cells possess a single, non-motile primary cilium that plays an important role in mediating cellular signaling pathways, such as Hedgehog (Hh) signaling. Primary cilia are present on testicular somatic cells and demonstrate a temporal expression during development; however
Daolu Zhan et al.
Molecular medicine reports, 16(5), 6590-6599 (2017-09-14)
Intraflagellar transport protein 88 (IFT88) is protein crucial for the assembly and maintenance of primary cilia in chondrocytes. Primary cilia regulate mechanical and chemical signals in chondrocytes; however, the effects of cytokines on IFT88 expression and cilia formation and maintenance
Qike Huang et al.
Cancer letters, 402, 52-60 (2017-05-26)
Determining the origin of liver cancer stem cells is important for treating hepatocellular carcinoma. Tg737 deficiency plays an important role in the malignant transformation of liver stem cells, but the underlying mechanism remains unclear. Here we established a chemical-induced mouse
Matthew E Deren et al.
International journal of molecular sciences, 17(2), 188-188 (2016-02-11)
Chondroprogenitors and hypertrophic chondrocytes, which are the first and last stages of the chondrocyte differentiation process, respectively, are sensitive to mechanical signals. We hypothesize that the mechanical sensitivity of these cells depends on the cell surface primary cilia. To test
Wengui Shi et al.
Bone, 136, 115346-115346 (2020-04-03)
Microgravity-induced bone deterioration is a major challenge in long-term spaceflights since the underlying mechanisms remain elusive. Previously, we reported that primary cilia of osteoblasts gradually disappeared in microgravity conditions, and cilia abrogation was necessary for the inhibition of osteogenesis induced

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service