Skip to Content
Merck
All Photos(1)

Documents

EHU020001

Sigma-Aldrich

MISSION® esiRNA

targeting human IRF3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGCACAGCAGGAGGATTTCGGAATCTTCCAGGCCTGGGCCGAGGCCACTGGTGCATATGTTCCCGGGAGGGATAAGCCAGACCTGCCAACCTGGAAGAGGAATTTCCGCTCTGCCCTCAACCGCAAAGAAGGGTTGCGTTTAGCAGAGGACCGGAGCAAGGACCCTCACGACCCACATAAAATCTACGAGTTTGTGAACTCAGGAGTTGGGGACTTTTCCCAGCCAGACACCTCTCCGGACACCAATGGTGGAGGCAGTACTTCTGATACCCAGGAAGACATTCTGGATGAGTTACTGGGTAACATGGTGTTGGCCCCACTCCCAGATCCGGGACCCCCAAGCCTGGCTGTAGCCCCTGAGCCCTGCCCTCAGCCCCTGCGGAGCCCCAGCTTGGACAATCCCACTCCCTTCCCAAACCTGGGGCCCTCTGAGAACCCACTGAAGCGGCTGTTGGTGCCGGGGGAAGAGTGGGAGTTCGAGGTGACAGCCTTCTACCG

Ensembl | human accession no.

ENSG00000126456

NCBI accession no.

NM_001571

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IRF3(3661) , IRF3(3661)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nanae Harashima et al.
Molecular cancer, 13, 217-217 (2014-09-18)
Synthetic double-stranded RNA poly(I:C) is a useful immune adjuvant and exhibits direct antitumor effects against several types of cancers. In this study, we elucidated the mechanisms underlying the effects induced in poly(I:C)-transfected human renal cell carcinoma (RCC) cells. In contrast
Xiao-Hua Wang et al.
The international journal of biochemistry & cell biology, 87, 8-17 (2017-03-25)
Respiratory syncytial virus (RSV) is the leading cause of bronchiolitis in infancy, which is a major risk factor for recurrent wheezing and asthma. Orosomucoid 1-like protein 3 (ORMDL3) has been reported to associate with virus-triggered recurrent wheezing and asthma in
Danielle N Kroetz et al.
PLoS pathogens, 11(12), e1005338-e1005338 (2015-12-29)
Influenza A virus (IAV) is an airborne pathogen that causes significant morbidity and mortality each year. Macrophages (Mϕ) are the first immune population to encounter IAV virions in the lungs and are required to control infection. In the present study
Iris F Ueki et al.
The Journal of experimental medicine, 210(10), 1929-1936 (2013-09-04)
Viruses suppress host responses to increase infection, and understanding these mechanisms has provided insights into cellular signaling and led to novel therapies. Many viruses (e.g., Influenza virus, Rhinovirus [RV], Cytomegalovirus, Epstein-Barr virus, and Hepatitis C virus) activate epithelial epidermal growth
Shen Yang et al.
Scientific reports, 6, 29665-29665 (2016-07-15)
SAMHD1 is a type I interferon (IFN) inducible host innate immunity restriction factor that inhibits an early step of the viral life cycle. The underlying mechanisms of SAMHD1 transcriptional regulation remains elusive. Here, we report that inducing SAMHD1 upregulation is
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service