Skip to Content
Merck
All Photos(1)

Key Documents

EMU025021

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ccrk

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCCTAGGAGCACCTCTTTCTGATTTGCCTCCATGGCCTCCCCACGGCTATATATACCACACCTGGTCCTGCTCCTTAGTGTGCTTGAGGGCTGGGCTCTGGGAGGCAGAACCGTGAGATGTTCATCCCAGCAGAGAAAGAGACTCACGTCCTACAGACAAAGCCTCCAGAAACTGCTAGCTGTGTCCTTCTCCAGGGCCACCCCTCAGTGGTGCCACCCGGCCTTAGAGATGATTGTCAGGCTCTGTCCCCTCTTCAAGGACATTGGTACTACAGCACCACCTGGTGGAAGCACAGAGTATAAGCTGTCTTCATACCGGGGACACAGCTGGGAAGTCAGACATGTTTTAGTTTTGGTTCCACTGGGTCAGGATTTGAGGTTCATATAAAAGCCCTGGGTGTTTCTGTCTAATTGCACCTTGTCTGTTGCTGTTAGGGAAAGGACAATGGTGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hai Feng et al.
Journal of hepatology, 62(5), 1100-1111 (2014-12-17)
Aberrant chromatin modification is a key feature of hepatocellular carcinoma (HCC), which is characterized by strong sexual dimorphism. Both enhancer of zeste homolog 2 (EZH2) and cell cycle-related kinase (CCRK) contribute to hepatocarcinogenesis, yet whether the two oncogenic factors have
Zhuo Yu et al.
Gut, 63(11), 1793-1804 (2014-01-21)
Androgen receptor (AR) signalling contributes to male predominance in hepatocellular carcinoma (HCC), which is more pronounced in HBV-endemic areas. Cell cycle-related kinase (CCRK) is essential for AR-induced hepatocarcinogenesis but its molecular function in HBV-associated HCC remains obscure. To determine the
Bin You et al.
Oncotarget, 6(6), 4357-4368 (2015-03-05)
Alterations of the EGFR/ERK and Hippo/YAP pathway have been found in non-small cell lung cancer (NSCLC). Herein, we show that ERK1 and ERK2 have an effect on the Hippo/YAP pathway in human NSCLC cells. Firstly, inhibition of ERK1/2 by siRNA

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service