Skip to Content
Merck
All Photos(1)

Documents

EHU090231

Sigma-Aldrich

MISSION® esiRNA

targeting human REST

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCGAGTATCACTGGAGGAAACATTTAAGAAACCATTTTCCAAGGAAAGTATACACATGTGGAAAATGCAACTATTTTTCAGACAGAAAAAACAATTATGTTCAGCATGTTAGAACTCATACAGGAGAACGCCCATATAAATGTGAACTTTGTCCTTACTCAAGTTCTCAGAAGACTCATCTAACTAGACATATGCGTACTCATTCAGGTGAGAAGCCATTTAAATGTGATCAGTGCAGTTATGTGGCCTCTAATCAACATGAAGTAACCCGCCATGCAAGACAGGTTCACAATGGGCCTAAACCTCTTAATTGCCCACACTGTGATTACAAAACAGCAGATAGAAGCAACTTCAAAAAACATGTAGAGCTACATGTGAACCCACGGCAGTTCAATTGCCCTGTATGTGACTATGCAGCTTCCAAG

Ensembl | human accession no.

ENSG00000084093

NCBI accession no.

NM_005612

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... REST(5978) , REST(5978)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Rui Wang et al.
International journal of molecular medicine, 42(5), 2831-2838 (2018-08-23)
Type 1 diabetes involves the immunologically mediated destruction of insulin‑producing cells (IPCs) in the pancreatic islet. Mesenchymal stem cells (MSCs) have the ability to differentiate into IPCs and have become the most promising means for diabetes therapy. The present study
Gopal Pandi et al.
PloS one, 8(3), e58039-e58039 (2013-03-22)
Recent studies showed that stroke extensively alters cerebral microRNA (miRNA) expression profiles and several miRNAs play a role in mediating ischemic pathophysiology. We currently evaluated the significance of miR-29c, a highly expressed miRNA in rodent brain that was significantly down-regulated
Wai Hon Chooi et al.
Biomaterials science, 6(11), 3019-3029 (2018-10-03)
The use of human induced pluripotent stem cell-derived neural progenitor cells (hiPSC-NPCs) is an attractive therapeutic option for damaged nerve tissues. To direct neuronal differentiation of stem cells, we have previously developed an electrospun polycaprolactone nanofiber scaffold that was functionalized
James C Geoghegan et al.
Molecular therapy. Nucleic acids, 1, e53-e53 (2012-01-01)
Delivery of small interfering RNA (siRNA) targeted to specific cell types is a significant challenge for the development of RNA interference-based therapeutics. Recently, PTD-DRBD, a double-stranded RNA binding domain (DRBD) fused to the TAT protein transduction domain (PTD), was shown
Wei Wang et al.
Molecular biology of the cell, 22(6), 868-879 (2011-01-29)
Developing neurons undergo a series of maturational stages, and the timing of these events is critical for formation of synaptic circuitry. Here we addressed temporal regulation of the Gabra6 gene, which is expressed in a delayed manner during dendritogenesis in
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service