Skip to Content
Merck
All Photos(1)

Documents

EHU140681

Sigma-Aldrich

MISSION® esiRNA

targeting human KHDRBS1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCAAATATGCCCACTTGAATATGGATCTGCATGTCTTCATTGAAGTCTTTGGACCCCCATGTGAGGCTTATGCTCTTATGGCCCATGCCATGGAGGAAGTCAAGAAATTTCTAGTACCGGATATGATGGATGATATCTGTCAGGAGCAATTTCTAGAGCTGTCCTACTTGAATGGAGTACCTGAACCCTCTCGTGGACGTGGGGTGCCAGTGAGAGGCCGGGGAGCTGCACCTCCTCCACCACCTGTTCCCAGGGGCCGTGGTGTTGGACCACCTCGGGGGGCTTTGGTACGTGGTACACCAGTAAGGGGAGCCATCACCAGAGGTGCCACTGTGACTCGAGGCGTGCCACCCCCACCTACTGTGAGGGGTGCTCCAGCACCAAGAGCACGGACAGCGGGCATCCAGAGGATACCTTTGCCTCCACCTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Shasha Tao et al.
Environmental toxicology, 34(5), 594-609 (2019-01-31)
Fine particulate matter is a well-known air pollutant threatening public health. Studies have confirmed long-term exposure to the particles could decrease the pulmonary function, induce asthma exacerbation, and chronic obstructive pulmonary disease, as well as increase the incidence and mortality
Teresa Vilariño-García et al.
Endocrine connections, 9(6), 479-488 (2020-05-07)
Polycystic ovary syndrome (PCOS) is a complex metabolic disorder associated with ovulatory dysfunction, hyperandrogenism, obesity, and insulin resistance, that leads to subfertility. Sam68 is an RNA-binding protein with signaling functions that is ubiquitously expressed, including gonads. Sam68 is recruited to
Hua Zhang et al.
Journal of virology, 89(19), 10031-10043 (2015-07-24)
Enterovirus 71 (EV71) recruits various cellular factors to assist in the replication and translation of its genome. Identification of the host factors involved in the EV71 life cycle not only will enable a better understanding of the infection mechanism but

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service