Skip to Content
Merck
All Photos(1)

Documents

EHU063201

Sigma-Aldrich

MISSION® esiRNA

targeting human TACC3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAACTGGGGAAGATCATGGACAGGTTCGAAGAGGTTGTGTACCAGGCCATGGAGGAAGTTCAGAAGCAGAAGGAACTTTCCAAAGCTGAAATCCAGAAAGTTCTAAAAGAAAAAGACCAACTTACCACAGATCTGAACTCCATGGAGAAGTCCTTCTCCGACCTCTTCAAGCGTTTTGAGAAACAGAAAGAGGTGATCGAGGGCTACCGCAAGAACGAAGAGTCACTGAAGAAGTGCGTGGAGGATTACCTGGCAAGGATCACCCAGGAGGGCCAGAGGTACCAAGCCCTGAAGGCCCACGCGGAGGAGAAGCTGCAGCTGGCAAACGAGGAGATCGCCCAGGTCCGGAGCAAGGCCCAGGCGGAAGCGTTGGCCCTCCAGGCCAGCCTGAGGAAGGAGCAGATGCGCATCCAGTCGCTGGAGAAGACAGTGGAGCAGAAGACTAAAGAGAACGAGGAGCTGACCAGGATCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Feng Guo et al.
Oncology research, 26(2), 183-189 (2017-01-22)
Transforming acidic coiled-coil protein 3 (TACC3) is a member of the TACC family and plays an important role in regulating cell mitosis, transcription, and tumorigenesis. However, the expression pattern and roles of TACC3 in renal cell carcinoma (RCC) remain unclear.
Congran Zhao et al.
Oncology letters, 15(5), 6881-6886 (2018-05-05)
TACC3, a member of the transforming acidic coiled-coil protein (TACC) family, is a multifunctional protein that is involved in various biological functions, including proliferation and differentiation of tumor cells, cancer progression and metastasis. The aims of the present study were
Colleen Furey et al.
Cell reports, 30(1), 269-283 (2020-01-09)
End-binding proteins (EBs) are widely viewed as master regulators of microtubule dynamics and function. Here, we show that while EB1 mediates the dynamic microtubule capture of herpes simplex virus type 1 (HSV-1) in fibroblasts, in neuronal cells, infection occurs independently

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service