Skip to Content
Merck
All Photos(1)

Documents

EMU060801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stk11

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGAGGCCAACGTCAAGAAGGAGATCCAGCTGCTGCGGCGGCTGCGGCATCGGAATGTGATCCAGCTTGTGGACGTGCTGTACAATGAGGAGAAGCAGAAGATGTATATGGTGATGGAGTACTGCGTATGTGGCATGCAGGAGATGCTGGACAGTGTGCCGGAGAAGCGCTTCCCTGTGTGCCAAGCTCATGGGTACTTCCGCCAGCTGATTGACGGCCTGGAATACCTACACAGCCAGGGCATTGTTCACAAGGACATCAAGCCGGGCAACCTGCTACTCACCACCAATGGCACACTCAAGATCTCCGACCTCGGTGTTGCCGAGGCCCTGCACCCTTTCGCTGTGGATGACACCTGCCGGACAAGCCAGGGCTCCCCGGCCTTCCAGCCTCCTGAGATTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Fanny Dupuy et al.
Cancer & metabolism, 1(1), 18-18 (2013-11-28)
Germline and somatic mutations in STK11, the gene encoding the serine/threonine kinase LKB1, are strongly associated with tumorigenesis. While loss of LKB1 expression has been linked to breast cancer, the mechanistic role of LKB1 in regulating breast cancer development, metastasis
Juan Li et al.
Journal of experimental & clinical cancer research : CR, 33, 70-70 (2014-09-03)
LKB1, also known as STK11, is a master kinase that serves as an energy metabolic sensor and is involved in cell polarity regulation. Recent studies have indicated that LKB1 is related to breast tumorigenesis and breast cancer progression. However, little
Ngai Na Co et al.
Cancer, 120(22), 3457-3468 (2014-07-22)
Liver kinase B1 (LKB1) is a serine/threonine kinase that functions as a tumor suppressor and regulates cell polarity, proliferation, and metabolism. Mutations in LKB1 are associated with Peutz-Jeghers syndrome as well as sporadic cervical and lung cancers. Although LKB1-null mice
Shabnam Pooya et al.
Nature communications, 5, 4993-4993 (2014-09-27)
A prerequisite to myelination of peripheral axons by Schwann cells (SCs) is SC differentiation, and recent evidence indicates that reprogramming from a glycolytic to oxidative metabolism occurs during cellular differentiation. Whether this reprogramming is essential for SC differentiation, and the
Kaisheng Mao et al.
Lung cancer (Amsterdam, Netherlands), 88(2), 131-138 (2015-03-15)
The tumor suppressor LKB1 has recently been shown to be involved in the regulation of microtubule dynamics, thus cancer cells with inactivated LKB1 may have developed a means to overcome dysregulated microtubule functions, making them intrinsically resistant to microtubule targeting

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service