Skip to Content
Merck
All Photos(1)

Key Documents

EHU149911

Sigma-Aldrich

MISSION® esiRNA

targeting human CSPG4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTACAGGGCACAAGGCTGTCAGATGGCCAGGGCTTCACCCAGGATGACATACAGGCTGGCCGGGTGACCTATGGGGCCACAGCACGTGCCTCAGAGGCAGTCGAGGACACCTTCCGTTTCCGTGTCACAGCTCCACCATATTTCTCCCCACTCTATACCTTCCCCATCCACATTGGTGGTGACCCAGATGCGCCTGTCCTCACCAATGTCCTCCTCGTGGTGCCTGAGGGTGGTGAGGGTGTCCTCTCTGCTGACCACCTCTTTGTCAAGAGTCTCAACAGTGCCAGCTACCTCTATGAGGTCATGGAGCGGCCCCGCCATGGGAGGTTGGCTTGGCGTGGGACACAGGACAAGACCACTATGGTGACATCCTTCACCAATGAAGACCTGTTGCGTGGCCGGCTGGTCTACCAGCATGATGACTCCGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jianbo Yang et al.
Melanoma research, 29(4), 365-375 (2019-05-30)
Chondroitin sulfate proteoglycan 4 (CSPG4) is a cell surface proteoglycan that enhances malignant potential in melanoma and several other tumor types. CSPG4 functions as a transmembrane scaffold in melanoma cells to activate oncogenic signaling pathways such as focal adhesion kinase
Sridevi Yadavilli et al.
Oncotarget, 6(14), 12141-12155 (2015-05-20)
Diffuse intrinsic pontine gliomas (DIPGs) have a dismal prognosis and are poorly understood brain cancers. Receptor tyrosine kinases stabilized by neuron-glial antigen 2 (NG2) protein are known to induce gliomagenesis. Here, we investigated NG2 expression in a cohort of DIPG
Frank Maus et al.
PloS one, 10(9), e0137311-e0137311 (2015-09-05)
The NG2 proteoglycan is characteristically expressed by oligodendrocyte progenitor cells (OPC) and also by aggressive brain tumours highly resistant to chemo- and radiation therapy. Oligodendrocyte-lineage cells are particularly sensitive to stress resulting in cell death in white matter after hypoxic

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service