Skip to Content
Merck
All Photos(1)

Documents

EHU153671

Sigma-Aldrich

MISSION® esiRNA

targeting human PTX3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTCAGAGGAAGGGCTCACATCCTTGTGGGTAAATGGTGAACTGGCGGCTACCACTGTTGAGATGGCCACAGGTCACATTGTTCCTGAGGGAGGAATCCTGCAGATTGGCCAAGAAAAGAATGGCTGCTGTGTGGGTGGTGGCTTTGATGAAACATTAGCCTTCTCTGGGAGACTCACAGGCTTCAATATCTGGGATAGTGTTCTTAGCAATGAAGAGATAAGAGAGACCGGAGGAGCAGAGTCTTGTCACATCCGGGGGAATATTGTTGGGTGGGGAGTCACAGAGATCCAGCCACATGGAGGAGCTCAGTATGTTTCATAAATGTTGTGAAACTCCACTTGAAGCCAAAGAAAGAAACTCACACTTAAAACACATGCCAGTTGGGAAGGTCTGAAAACTCAGTGCATAATAGGAACACTTGAGACTAATGAAAGAGAGAGTTGAGACCAATCTTTATTTGTACTGGCCAAATACTGAATAAACAGTTGAAGGAAAGACATTGGAAAAAGCTTTTGAGGATAATGTTACTAGACTTTATGCCATGGTGCTTTCA

Ensembl | human accession no.

ENSG00000163661

NCBI accession no.

NM_002852

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PTX3(5806) , PTX3(5806)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Christina L O'Neill et al.
Cardiovascular research, 112(3), 677-688 (2016-09-24)
Circulating angiogenic cells (CACs) promote revascularization of ischaemic tissues although their underlying mechanism of action and the consequences of delivering varying number of these cells for therapy remain unknown. This study investigates molecular mechanisms underpinning CAC modulation of blood vessel
Shih-Hung Chan et al.
Oncotarget, 8(25), 41364-41378 (2017-05-11)
The association between metabolic diseases and the risk of developing cancer is emerging. However, the impact of long pentraxin-3 (PTX3) on dyslipidemia-associated tumor metastasis remains unknown. In this study, we found that oleate induced PTX3 expression and secretion through the
Xian-Yuan Luo et al.
Cell biology international (2018-05-10)
MicroRNAs (miRNAs) have been known to function as important regulators in the vascular system, with various physiopathological effects such as vascular remodeling and hypertension modulation. We aimed to explore whether microRNA-150 (miR-150) regulates endothelial cell function and vascular remodeling in
Hyeon Joo Ham et al.
Journal of neuroinflammation, 17(1), 350-350 (2020-11-24)
Alzheimer's disease (AD) is one of the most prevalent neurodegenerative disorders characterized by gradual memory loss and neuropsychiatric symptoms. We have previously demonstrated that the 2-({3-[2-(1-cyclohexene-1-yl)ethyl]-6,7-dimethoxy-4-oxo-3,4-dihydro-2-quinazolinyl}sulfanyl)-N-(4-ethylphenyl)butanamide (K284-6111), the inhibitor of CHI3L1, has the inhibitory effect on memory impairment in Αβ
Peiyuan Zhang et al.
Nature communications, 11(1), 2487-2487 (2020-05-20)
Cancer stem-like cells (CSCs) are the tumorigenic cell subpopulation and contribute to cancer recurrence and metastasis. However, the understanding of CSC regulatory mechanisms remains incomplete. By transcriptomic analysis, we identify a scaffold protein SH3RF3 (also named POSH2) that is upregulated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service