Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU059761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gsk3b

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACAGGCCACAGGAAGTCAGTTATACAGACACGAAAGTGATTGGAAATGGATCATTTGGTGTGGTATATCAAGCCAAACTTTGTGATTCTGGAGAACTGGTTGCCATCAAGAAAGTTCTACAGGACAAGCGATTTAAGAACCGAGAGCTCCAGATCATGAGAAAGCTAGACCACTGTAACATAGTCCGACTGCGGTATTTCTTCTACTCGAGTGGCGAGAAGAAAGATGAGGTCTACCTTAACCTGGTGCTGGACTATGTTCCGGAGACAGTGTACAGAGTCGCCAGACACTATAGTCGAGCCAAGCAGACACTCCCTGTGATCTATGTCAAGTTGTATATGTATCAGCTGTTCAGAAGTCTAGCCTATATCCATTCCTTTGGAATCTGCCATCGAGACAT

Numéro d'accès Ensembl | souris

ENSMUSG00000022812

Numéro d'accès NCBI

NM_019827

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... GSK3B(56637) , Gsk3b(56637)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yunfeng Fu et al.
OncoTargets and therapy, 7, 1159-1168 (2014-07-17)
Glycogen synthase kinase-3 (GSK-3) plays an important role in human cancer. The aim of this study is to evaluate the clinicopathological significance of expression of GSK-3α/β and pGSK-3α/β(Tyr279/216) in patients with epithelial ovarian cancer and to investigate whether GSK-3 inhibition
Linna Liu et al.
Oncology reports, 32(4), 1395-1400 (2014-08-12)
Rac1 has been shown to regulate the cell cycle in cancer cells. Yet, the related mechanism remains unclear. Thus, the present study aimed to investigate the mechanism involved in the regulation of G1/S phase transition by Rac1 in cancer cells.
I Azoulay-Alfaguter et al.
Oncogene, 34(35), 4613-4623 (2014-12-17)
There is controversy over the role of glycogen synthase kinase-3 (GSK-3) in cancer progression. Recent work has implicated GSK-3 in the regulation of mammalian target of rapamycin (mTOR), a known player in malignant transformation. Autophagy, a self-degradation pathway, is inhibited

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique