Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU157281

Sigma-Aldrich

MISSION® esiRNA

targeting human ALAS1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTGGGGCAGTTATGGACACTTTGAAACAACATGGTGCTGGGGCAGGTGGTACTAGAAATATTTCTGGAACTAGTAAATTCCATGTGGACTTAGAGCGGGAGCTGGCAGACCTCCATGGGAAAGATGCCGCACTCTTGTTTTCCTCGTGCTTTGTGGCCAATGACTCAACCCTCTTCACCCTGGCTAAGATGATGCCAGGCTGTGAGATTTACTCTGATTCTGGGAACCATGCCTCCATGATCCAAGGGATTCGAAACAGCCGAGTGCCAAAGTACATCTTCCGCCACAATGATGTCAGCCACCTCAGAGAACTGCTGCAAAGATCTGACCCCTCAGTCCCCAAGATTGTGGCATTTGAAACTGTCCATTCAATGGATGGGGCGGTGTGCCCACTGGAAGAGCTGTGTGATGTGGC

Numéro d'accès Ensembl | humain

ENSG00000023330

Numéro d'accès NCBI

NM_000688

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ALAS1(211) , ALAS1(211)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yalei Zhao et al.
Saudi journal of gastroenterology : official journal of the Saudi Gastroenterology Association, 26(3), 144-152 (2020-04-10)
Colorectal cancer (CRC) is the third most common malignant tumour worldwide and the second leading cause of cancer-related deaths. Commonly, 5'-aminolevulinic acid synthase1 (ALAS1) is the rate-limiting enzyme for haem biosynthesis. Recent studies have shown that ALAS1 is involved in
Taka-Aki Takeda et al.
Biochimica et biophysica acta, 1861(7), 1813-1824 (2017-03-30)
The degradation of heme significantly contributes to cytoprotective effects against oxidative stress and inflammation. The enzyme heme oxygenase-1 (HO-1), involved in the degradation of heme, forms carbon monoxide (CO), ferrous iron, and bilirubin in conjunction with biliverdin reductase, and is

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique