Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU155611

Sigma-Aldrich

MISSION® esiRNA

targeting human KDR

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCGATGGCCTCTTCTGTAAGACACTCACAATTCCAAAAGTGATCGGAAATGACACTGGAGCCTACAAGTGCTTCTACCGGGAAACTGACTTGGCCTCGGTCATTTATGTCTATGTTCAAGATTACAGATCTCCATTTATTGCTTCTGTTAGTGACCAACATGGAGTCGTGTACATTACTGAGAACAAAAACAAAACTGTGGTGATTCCATGTCTCGGGTCCATTTCAAATCTCAACGTGTCACTTTGTGCAAGATACCCAGAAAAGAGATTTGTTCCTGATGGTAACAGAATTTCCTGGGACAGCAAGAAGGGCTTTACTATTCCCAGCTACATGATCAGCTATGCTGGCATGGTCTTCTGTGAAGCAAAAATTAATGATGAAAGTTACCAGTCTATTATGTACATAGTTGTCGTTGTAGGGTATAGGATTTATGATGTGGTTCTGAGTCCGTCTCATGGAA

Numéro d'accès Ensembl | humain

ENSG00000128052

Numéro d'accès NCBI

NM_002253

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KDR(3791) , KDR(3791)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Evan Bailey et al.
The American journal of pathology, 187(1), 25-32 (2016-11-16)
Vascular endothelial growth factor (VEGF)-D is capable of inducing angiogenesis and lymphangiogenesis through signaling via VEGF receptor (VEGFR)-2 and VEGFR-3, respectively. Mutations in the FIGF (c-fos-induced growth factor) gene encoding VEGF-D have not been reported previously. We describe a young
W-Z Hou et al.
European review for medical and pharmacological sciences, 21(5), 1080-1087 (2017-03-25)
Cerebral aneurysm is a common vascular disease with high morbidity and mortality. Vascular smooth muscle deletion or dysplasia is an important reason for the development of cerebral aneurysm. MiRNAs participate in a variety of biological functions through inhibiting target gene
Lin-Bin Zhou et al.
International journal of ophthalmology, 13(7), 1039-1045 (2020-07-21)
To identify proangiogenic factors engaged in neovascular age-related macular degeneration (AMD) except vascular endothelial growth factor (VEGF) from human retinal pigment epithelial (hRPE) cells and investigate the underlying mechanisms. VEGF receptor 2 (VEGFR2) in ARPE-19 cells was depleted by siRNA
Chao Ji et al.
Oncotarget, 7(51), 84748-84757 (2016-10-08)
Ultra Violet (UV) radiation induces reactive oxygen species (ROS) production, DNA oxidation and single strand breaks (SSBs), which will eventually lead to skin cell damages or even skin cancer. Here, we tested the potential activity of gremlin, a novel vascular
Kyung In Baek et al.
Antioxidants & redox signaling, 28(1), 31-43 (2017-08-02)
Hemodynamic shear stress participates in maintaining vascular redox status. Elucidating flow-mediated endothelial metabolites enables us to discover metabolic biomarkers and therapeutic targets. We posited that flow-responsive vascular endothelial growth factor receptor (VEGFR)-protein kinase C isoform epsilon (PKCɛ)-6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3) signaling
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique