Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU106621

Sigma-Aldrich

MISSION® esiRNA

targeting human SUMO1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCAAAGACAGGGTGTTCCAATGAATTCACTCAGGTTTCTCTTTGAGGGTCAGAGAATTGCTGATAATCATACTCCAAAAGAACTGGGAATGGAGGAAGAAGATGTGATTGAAGTTTATCAGGAACAAACGGGGGGTCATTCAACAGTTTAGATATTCTTTTTATTTTTTTTCTTTTCCCTCAATCCTTTTTTATTTTTAAAAATAGTTCTTTTGTAATGTGGTGTTCAAAACGGAATTGAAAACTGGCACCCCATCTCTTTGAAACATCTGGTAATTTGAATTCTAGTGCTCATTATTCATTATTGTTTGTTTTCATTGTGCTGATTTTTGGTGATCAAGCCTCAGTCCCCTTCATATTACCCTCTCCTTTTTAAAAATTACGTGTGCACAGAGAGGTCACCTTTTTCAGGACATTGCATTTTCAGGC

Numéro d'accès Ensembl | humain

ENSG00000116030

Numéro d'accès NCBI

NM_003352

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SUMO1(7341) , SUMO1(7341)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yufeng Yao et al.
Pulmonary pharmacology & therapeutics, 55, 38-49 (2019-02-01)
Pulmonary arterial hypertension (PAH) is a life-threatening disease without effective therapies. PAH is associated with a progressive increase in pulmonary vascular resistance and irreversible pulmonary vascular remodeling. SUMO1 (small ubiquitin-related modifier 1) can bind to target proteins and lead to
Dao-Ying Yuan et al.
Oncology reports, 38(4), 2360-2368 (2017-08-10)
Radiotherapy is one of the most effective non-surgical treatments for oral squamous cell carcinoma. However, radioresistance remains a major impediment to radiotherapy. Although BetA (Betulinic acid) can induce radiosensitization, the underlying mechanism and whether it could induce radiosensitization in oral
Sabine Hergovits et al.
Journal of cellular and molecular medicine, 21(11), 3087-3099 (2017-06-01)
Interleukin (IL)-6-type cytokines have no direct antiviral activity; nevertheless, they display immune-modulatory functions. Oncostatin M (OSM), a member of the IL-6 family, has recently been shown to induce a distinct number of classical interferon stimulated genes (ISG). Most of them
Lin-Nan Zhu et al.
Frontiers in cellular neuroscience, 12, 262-262 (2018-09-11)
Methamphetamine (METH) is an illegal and widely abused psychoactive stimulant. METH abusers are at high risk of neurodegenerative disorders, including Parkinson's disease (PD). Previous studies have demonstrated that METH causes alpha-synuclein (α-syn) aggregation in the both laboratory animal and human.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique