Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU080971

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCTATGGAGCAAGTTCTGCAGATGGTTCCAGAGACGGGAGTCCTGGGCCCAGAGCCGAGATGAGCAGAACCTGCTGCAGCAGAAGAGGATCTGGGAGTCTCCTCTCCTTCTAGCTGCCAAAGATAATGATGTCCAGGCCCTGAACAAGTTGCTCAAGTATGAGGATTGCAAGGTGCACCAGAGAGGAGCCATGGGGGAAACAGCGCTACACATAGCAGCCCTCTATGACAACCTGGAGGCCGCCATGGTGCTGATGGAGGCTGCCCCGGAGCTGGTCTTTGAGCCCATGACATCTGAGCTCTATGAGGGTCAGACTGCACTGCACATCGCTGTTGTGAACCAGAACATGAACCTGGTGCGAGCCCTGCTTGCCCGCAGGGCCAGTGTCTCTGCCAGAGCCACAGGCACTGCCTTCCGCCGTAGTCCCTGCAACCTCAT

Numéro d'accès Ensembl | humain

ENSG00000165125

Numéro d'accès NCBI

NM_018646

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TRPV6(55503) , TRPV6(55503)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

M Skrzypski et al.
Biochimica et biophysica acta, 1853(12), 3202-3210 (2015-09-20)
Transient receptor potential channel vanilloid type 6 (TRPV6) is a non-selective cation channel with high permeability for Ca²⁺ ions. So far, the role of TRPV6 in pancreatic beta cells is unknown. In the present study, we characterized the role of
Cuiping Liu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 51(4), 1695-1709 (2018-12-07)
Parathyroid hormone-related protein (PTHrP) is implicated in regulating calcium homeostasis in vertebrates, including sea bream, chick, and mammals. However, the molecular mechanism underlying the function of PTHrP in regulating calcium transport is still not fully investigated. This study aimed to
Shigenori Miura et al.
Nature communications, 6, 8871-8871 (2015-11-14)
Microvilli are cellular membrane protrusions present on differentiated epithelial cells, which can sense and interact with the surrounding fluid environment. Biochemical and genetic approaches have identified a set of factors involved in microvilli formation; however, the underlying extrinsic regulatory mechanism
H Bond et al.
The Journal of physiology, 586(7), 2015-2025 (2008-02-09)
The role of parathyroid hormone-related protein (PTHrP) in fetal calcium homeostasis and placental calcium transport was examined in mice homozygous for the deletion of the PTHrP gene (PTHrP-/- null; NL) compared to PTHrP+/+ (wild-type; WT) and PTHrP+/- (heterozygous; HZ) littermates.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique