Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU073641

Sigma-Aldrich

MISSION® esiRNA

targeting human ARNTL

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGAGGGACTCCAGACATTCCTTCCAGTGGCCTACTATCAGGCCAGGCTCAGGAGAACCCAGGTTATCCATATTCTGATAGTTCTTCTATTCTTGGTGAGAACCCCCACATAGGTATAGACATGATTGACAACGACCAAGGATCAAGTAGTCCCAGTAATGATGAGGCAGCAATGGCTGTCATCATGAGCCTCTTGGAAGCAGATGCTGGACTGGGTGGCCCTGTTGACTTTAGTGACTTGCCATGGCCGCTGTAAACACTACATGTTGCTTTGGCAACAGCTATAGTATCAAAGTGCATTACTGGTGGAGTTTTACAGTCTGTGAAGCTTACTGGATAAGGAGAGAATAGCTTTTATGTACTGACTTCATAAAAGCCATCTCAGAGCCATTGATACAAGTCAATCTTACTATATGTAACTTCAGACAAAGTGGAACTAAGCCTGCTCCA

Numéro d'accès Ensembl | humain

ENSG00000133794

Numéro d'accès NCBI

NM_001030272

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ARNTL(406) , ARNTL(406)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Whitney Sussman et al.
American journal of physiology. Cell physiology, 317(3), C492-C501 (2019-06-20)
The transcription factor aryl hydrocarbon receptor nuclear translocator-like protein-1 (BMAL1) is an essential regulator of the circadian clock, which controls the 24-h cycle of physiological processes such as nutrient absorption. To examine the role of BMAL1 in small intestinal glucose
Silke Kiessling et al.
BMC biology, 15(1), 13-13 (2017-02-16)
Circadian clocks control cell cycle factors, and circadian disruption promotes cancer. To address whether enhancing circadian rhythmicity in tumor cells affects cell cycle progression and reduces proliferation, we compared growth and cell cycle events of B16 melanoma cells and tumors
Hisashi Kato et al.
International journal of molecular sciences, 21(18) (2020-09-25)
Exercise training is well known to enhance adipocyte lipolysis in response to hormone challenge. However, the existence of a relationship between the timing of exercise training and its effect on adipocyte lipolysis is unknown. To clarify this issue, Wistar rats
Rukeia El-Athman et al.
PLoS biology, 15(12), e2002940-e2002940 (2017-12-08)
The mammalian circadian clock and the cell cycle are two major biological oscillators whose coupling influences cell fate decisions. In the present study, we use a model-driven experimental approach to investigate the interplay between clock and cell cycle components and
Nikolai Genov et al.
Scientific reports, 9(1), 11062-11062 (2019-08-01)
The circadian clock regulates key cellular processes and its dysregulation is associated to several pathologies including cancer. Although the transcriptional regulation of gene expression by the clock machinery is well described, the role of the clock in the regulation of
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique