Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU036931

Sigma-Aldrich

MISSION® esiRNA

targeting human ATG12

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGAACCATCCAAGGACTCATTGACTTCATCAAAAAGTTTCTTAAACTTGTGGCCTCAGAACAGTTGTTTATTTATGTGAATCAGTCCTTTGCTCCTTCCCCAGACCAAGAAGTTGGAACTCTCTATGAGTGTTTTGGCAGTGATGGTAAACTGGTTTTACATTACTGCAAGTCTCAGGCGTGGGGATGAACCACAAAGAAAATCAACTTGCTACTACATGAAATGGATTTTCACGGAAGAGACAGCTCTGAAAAGTTTTGATGCTTGTGGCAAGAGACTTAACAGATGTGATCTATTTAGTATGTGTCTACTCTATGTTTATGCATAAGAAAACATCCATAGCATGAATGGACTCAGAAAAATGTGATTTGTATTAATGCACCAGTCATCATAAAAGATGGTCATGATAGTACACCCATTGCTCCTACTTGTTACTATTATTGCTGCAGATCTGCCTCCAAGGTTGAAA

Numéro d'accès Ensembl | humain

ENSG00000145782

Numéro d'accès NCBI

NM_004707

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ATG12(9140) , ATG12(9140)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yingqiang Liu et al.
Cell death & disease, 11(3), 175-175 (2020-03-08)
Colorectal cancer (CRC) is a global healthcare problem. Radioresistance is a huge setback for CRC radiotherapy. In this text, the roles and molecular mechanisms of long non-coding RNA HOTAIR in CRC tumorigenesis and radioresistance were further investigated. ATG12 mRNA, HOTAIR
Sachiko Matsuzaki et al.
British journal of pharmacology, 175(10), 1637-1653 (2018-02-20)
A high recurrence rate after medical treatment is a major clinical problem for patients with endometriosis. Here, we have evaluated the in vitro effects of combined treatment with MK2206 (an AKT inhibitor) + chloroquine on cell growth and regrowth of endometriotic stromal
Yongqiang Chen et al.
Cancers, 13(5) (2021-04-04)
The epidermal growth factor receptor (EGFR) family member erb-b2 receptor tyrosine kinase 2 (ERBB2) is overexpressed in many types of cancers leading to (radio- and chemotherapy) treatment resistance, whereas the underlying mechanisms are still unclear. Autophagy is known to contribute
Sun-Jung Cho et al.
Autophagy, 11(1), 100-112 (2014-12-09)
Autophagy is one of the main mechanisms in the pathophysiology of neurodegenerative disease. The accumulation of autophagic vacuoles (AVs) in affected neurons is responsible for amyloid-β (Aβ) production. Previously, we reported that SUMO1 (small ubiquitin-like modifier 1) increases Aβ levels.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique