Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU016101

Sigma-Aldrich

MISSION® esiRNA

targeting human HEG1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGGAGGAAGTCACACAGCATTGGGAGATAGGAGTTATTCAGAGTCTTCATCTACATCTTCCTCGGAAAGCTTGAATTCATCAGCACCACGTGGAGAACGTTCGATCGCTGGGATTAGCTACGGTCAAGTGCGTGGCACAGCTATTGAACAAAGGACTTCCAGCGACCACACAGACCACACCTACCTGTCATCTACTTTCACCAAAGGAGAACGGGCGTTACTGTCCATTACAGATAACAGTTCATCCTCAGACATTGTGGAGAGCTCAACTTCTTATATTAAAATCTCAAACTCTTCACATTCAGAGTATTCCTCCTTTTTTCATGCTCAGACTGAGAGAAGTAACATCTCATCCTATGACGGGGAATATGCTCAGCCTTCTACTGAGTCGCCAGTTCTGCATACATCCAACCTTCCGTCCTACAC

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shoutaro Tsuji et al.
Scientific reports, 7, 45768-45768 (2017-04-01)
The absence of highly specific markers for malignant mesothelioma (MM) has served an obstacle for its diagnosis and development of molecular-targeting therapy against MM. Here, we show that a novel mucin-like membrane protein, sialylated protein HEG homolog 1 (HEG1), is
Tomomi Fujii et al.
Biochemical and biophysical research communications, 526(4), 927-933 (2020-04-15)
Malignant mesothelioma (MM) is a fatal tumor, and the absence of a specific diagnostic marker and/or a pathogenic molecule-targeting drug is a major issue for its pathological diagnosis and for targeting therapy. The molecular target of MM has not been

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique