Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU001321

Sigma-Aldrich

MISSION® esiRNA

targeting human MIOX

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACTCCACCTTCCAGGACAACCCTGACCTCCAGGATCCTCGATACAGCACAGAGCTCGGGATGTATCAGCCCCACTGTGGGCTCGACAGGGTCCTCATGTCCTGGGGCCATGATGAGTACATGTACCAGGTGATGAAGTTTAACAAGTTCTCACTGCCCCCTGAGGCTTTCTACATGATCCGGTTCCACTCCTTCTACCCCTGGCACACGGGCCGCGACTACCAGCAGCTGTGCAGCCAGCAGGACCTGGCCATGCTGCCCTGGGTGCGGGAGTTCAACAAGTTCGACCTCTACACCAAGTGCCCGGACCTGCCGGACGTGGACAAGCTGCGGCCCTACTACCAGGGGCTCATTGACAAGTACTGCCCTGGCATCCTGAGCTGGTGACCCTCCTGCCACCCAAGCTGCTGCTGGACCTAGGCCTGGCCCTCCGCCTGCCTGGAGAGGCCTGGCCCTGGGCAAACAGCCGCCATCAGGGTTCACCTCGGTGGGGGACCCCACTCACCCCCTTAGGGTCGCCACCCCTCACGGCAACTTGTGCCTGGCGTCAATAAAGACCTGGAAGGATGTTGTGCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tatsuya Tominaga et al.
The Journal of biological chemistry, 291(3), 1348-1367 (2015-11-19)
The kidney is one of the target organs for various metabolic diseases, including diabetes, metabolic syndrome, and obesity. Most of the metabolic studies underscore glomerular pathobiology, although the tubulo-interstitial compartment has been underemphasized. This study highlights mechanisms concerning the pathobiology
Isha Sharma et al.
Biomedicines, 8(7) (2020-07-28)
Obesity is associated with perturbations in cellular energy homeostasis and consequential renal injury leading to chronic renal disease (CKD). Myo-inositol oxygenase (MIOX), a tubular enzyme, alters redox balance and subsequent tubular injury in the settings of obesity. Mechanism(s) for such

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique