Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

AV38984

Sigma-Aldrich

Anti-MAFF antibody produced in rabbit

IgG fraction of antiserum

Synonyme(s) :

Anti-v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

100 μL
383,00 €

383,00 €


Date d'expédition estimée le06 avril 2025



Sélectionner une taille de conditionnement

Changer de vue
100 μL
383,00 €

About This Item

Code UNSPSC :
12352203
Nomenclature NACRES :
NA.41

383,00 €


Date d'expédition estimée le06 avril 2025


Source biologique

rabbit

Niveau de qualité

Conjugué

unconjugated

Forme d'anticorps

IgG fraction of antiserum

Type de produit anticorps

primary antibodies

Clone

polyclonal

Forme

buffered aqueous solution

Poids mol.

18 kDa

Espèces réactives

mouse, human, dog, bovine, horse, rat, guinea pig, rabbit

Concentration

0.5 mg - 1 mg/mL

Technique(s)

western blot: suitable

Numéro d'accès NCBI

Numéro d'accès UniProt

Conditions d'expédition

wet ice

Température de stockage

−20°C

Informations sur le gène

human ... MAFF(23764)

Immunogène

Synthetic peptide directed towards the N terminal region of human MAFF

Actions biochimiques/physiologiques

MAFF is a basic leucine zipper transcription factor that binds to the promoter of oxytocin receptor gene. It lacks a transactivation domain but forms a homodimer that can repress transcription.[1] MAFF reportedly regulates the gene expression in response to proinflammatory cytokines in myometrial cells.[2]

Séquence

Synthetic peptide located within the following region: SVRELNRHLRGLSAEEVTRLKQRRRTLKNRGYAASCRVKRVCQKEELQKQ

Forme physique

Purified antibody supplied in 1x PBS buffer with 0.09% (w/v) sodium azide and 2% sucrose.

Clause de non-responsabilité

Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals.

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Classe de danger pour l'eau (WGK)

WGK 1

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

T Kimura et al.
Biochemical and biophysical research communications, 264(1), 86-92 (1999-10-21)
The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term
Wael Massrieh et al.
Biology of reproduction, 74(4), 699-705 (2005-12-24)
The MAF (proto-)oncogene family of basic-leucine zipper transcription factors plays crucial roles in the control of mammalian gene expression and development. Here we analyzed the regulation of the human MAFF gene, coding for a small MAF transcription factor, in uterine
Daniel N Itzhak et al.
Disease models & mechanisms, 12(11) (2019-10-20)
The unfolded protein response (UPR) involves extensive proteome remodeling in many cellular compartments. To date, a comprehensive analysis of the UPR has not been possible because of technological limitations. Here, we employ stable isotope labeling with amino acids in cell

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique