Skip to Content
Merck
All Photos(1)

Documents

EHU026341

Sigma-Aldrich

MISSION® esiRNA

targeting human GLI1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCCAATCACAAGTCAGGTTCCTATCCCACCCCTTCACCATGCCATGAAAATTTTGTAGTGGGGGCAAATAGGGCTTCACATAGGGCAGCAGCACCACCTCGACTTCTGCCCCCATTGCCCACTTGCTATGGGCCTCTCAAAGTGGGAGGCACAAACCCCAGCTGTGGTCATCCTGAGGTGGGCAGGCTAGGAGGGGGTCCTGCCTTGTACCCTCCTCCCGAAGGACAGGTATGTAACCCCCTGGACTCTCTTGATCTTGACAACACTCAGCTGGACTTTGTGGCTATTCTGGATGAGCCCCAGGGGCTGAGTCCTCCTCCTTCCCATGATCAGCGGGGCAGCTCTGGACATACCCCACCTCCCTCTGGGCCCCCCAACATGGCTGTGGGCAACATGAGTGTCTTACTGAGATCCCTACCTGGGGAAACAGAATTCCTCAACTCTAGTGCCTAAAGAGTAGGGAATCTCATCCATCACAGATCGCAT

Ensembl | human accession no.

ENSG00000111087

NCBI accession no.

NM_005269

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GLI1(2735) , GLI1(2735)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yang Chong et al.
Journal of experimental & clinical cancer research : CR, 35(1), 175-175 (2016-11-12)
Gastric cancer (GC) is characterized by the excessive deposition of extracellular matrix, which is thought to contribute to this tumor's malignant behavior. Epithelial-mesenchymal transition (EMT) is regarded as a crucial contributing factor to cancer progression. Galectin-1 (Gal-1), a β-galactoside-binding protein
Xinyi Cai et al.
OncoTargets and therapy, 8, 877-883 (2015-05-07)
The Hedgehog (Hh) signaling pathway not only plays important roles in embryogenesis and adult tissue homeostasis, but also in tumorigenesis. Aberrant Hh pathway activation has been reported in a variety of malignant tumors including colon carcinoma. Here, we sought to
Yumei Diao et al.
Molecular oncology, 12(10), 1718-1734 (2018-08-12)
Hedgehog (HH) signaling is involved in many physiological processes, and pathway deregulation can result in a wide range of malignancies. Glioma-associated oncogene 1 (GLI1) is a transcription factor and a terminal effector of the HH cascade. Despite its crucial role
Hongjuan Yao et al.
International journal of nanomedicine, 15, 7013-7034 (2020-10-17)
Gastric cancer stem cells (CSCs) are important for the initiation, growth, recurrence, and metastasis of gastric cancer, due to their chemo-resistance and indefinite proliferation. Herein, to eliminate gastric CSCs, we developed novel CSC-targeting glioma-associated oncogene homolog 1 (Gli1) small interfering
Hideya Onishi et al.
Cellular immunology, 310, 199-204 (2016-08-16)
We investigated whether hypoxia-induced activation of Hh signaling contributes to PDL-1 expression in cancer and whether it affects the anti-tumor function of activated lymphocytes. Hypoxia augmented PDL-1 expression and inhibition of Hh signaling reduced PDL-1 expression under hypoxia. When activated
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service